Commit aec54d51 authored by Olivier Rue's avatar Olivier Rue
Browse files

curation D1D2 cheese

parent 59693191
Pipeline #44408 passed with stage
in 18 seconds
......@@ -380,7 +380,7 @@ sed "s/no data/NA;NA;NA;NA;NA;NA;NA/" 4.tsv |sed "s/no data/0/g" | grep 'FROGS_
tsv_to_biom.py --input-tsv 4-2.tsv --output-biom 4-2.biom
affiliation_filters.py --input-fasta 4.fasta --input-biom 4-2.biom --min-blast-identity 0.1 --delete
biom_to_tsv.py --input-biom affiliation-filtered.biom --output-tsv affiliation-filtered.tsv
affiliation_OTU.py --input-fasta affiliation-filtered.fasta --input-biom affiliation-filtered.biom --nb-cpus 8 --output-biom affiliation.biom --summary affiliation.html --reference D1D2.fasta
affiliation_OTU.py --input-fasta affiliation-filtered.fasta --input-biom affiliation-filtered.biom --nb-cpus 8 --output-biom affiliation.biom --summary affiliation.html --reference ~/work/D1D2.fasta
biom_to_tsv.py --input-biom affiliation.biom --output-tsv affiliation.tsv
......@@ -685,6 +685,438 @@ physeq_its2_final <- prune_taxa(keptTaxa, physeq_its2)
saveRDS(physeq_its2_final,"REAL_CHEESE/ITS2_final.rds")
```
```{r, eval=T}
t <- tax_table(physeq_d1d2)
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Species"] <- "Kluyveromyces Group lactis marxianus"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Genus"] <- "Kluyveromyces"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Family"] <- "Saccharomycetaceae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Species"] <- "Kluyveromyces Group lactis marxianus"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Genus"] <- "Kluyveromyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Family"] <- "Saccharomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Species"] <- "Saccharomyces cerevisiae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Genus"] <- "Saccharomyces"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Family"] <- "Saccharomycetaceae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Species"] <- "Wickerhamomyces anomalus"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Genus"] <- "Wickerhamomyces"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Family"] <- "Phaffomycetaceae"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Species"] <- "Zygosaccharomyces rouxii"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Genus"] <- "Zygosaccharomyces"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Family"] <- "Saccharomycetaceae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Species"] <- "Meyerozyma neustonensis"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Genus"] <- "Meyerozyma"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Species"] <- "Torulaspora Group delbrueckii quercuum franciscae pretoriensis maleeae microellipsoides"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Genus"] <- "Torulaspora"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Family"] <- "Saccharomycetaceae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGTAACTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTGCAGGAATGTAGCTTGCCTCGGTAAGTGTTATATCCTGTAGAAATACTGCCAGCTGGGACTGAGGACTGCGACTTTACGTCAAGGATGCTGGCATAATGGTTATATGCCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Species"] <- "Pichia membranifaciens"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Genus"] <- "Pichia"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Family"] <- "Pichiaceae"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Order"] <- "Saccharomycetales"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Class"] <- "Saccharomycetes"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACAGGGATTGCCCCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTAATTTTTTTGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTTTGTGGAGCACGGTGTCCAAGTCCCTTGGAACAGGGCGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCCGTGCGAAGCTCTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGGGAGAATGGGTGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGCGCCAGATACCGCGTGCGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCACAACGGCGCAATACCGC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Species"] <- "Aureobasidium leucospermi"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Genus"] <- "Aureobasidium"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Family"] <- "Dothioraceae"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Order"] <- "Dothideales"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Class"] <- "Dothideomycetes"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Phylum"] <- "Ascomycota"
t["AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTAGCCTTCGGGTTCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCATTGGGAATGTGGCCTCCACTTCGGTGGAGGTGTTATAGCCCAGTGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC_FROGS_combined","Kingdom"] <- "Fungi"
t["AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTGGAGGAAAAAATTAATAGGAATGTGGCCTTTCGAGGTGTTATAGCCTATTATCATACTCTGGATTGGACTGAGGAACGCAGTGAATGCCTTTAGGCAAGATTGCTGGGCGCTTTCGCTAATAAATGTTAGAATTTCTGCTTCGGGTGGTGCTAATGTTTAAAGGAGGAACTCGTTTAGTATATTTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC_FROGS_combined","Species"] <- "Mucor Group racemosus brunneogriseus"
t["AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTGGAGGAAAAAATTAATAGGAATGTGGCCTTTCGAGGTGTTATAGCTTATTATCATACTCTGGATTGGACTGAGGAACGCAGTGAATGCCTTTAGGCAAGATTGCTGGGCGCTTTCGCTAATAAATGTTAGAATTTCTGCTTCGGGTGGTGTTAATGTTTAAAGGAGGAACTCGTTTAGTATATTTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC_FROGS_combined","Species"] <- "Mucor Group racemosus brunneogriseus"
t["AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTATTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGAC_FROGS_combined","Species"] <- "Penicillium Group commune roqueforti caseifluvum expansum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTGGAGGAAAAAATTAATAGGAATGTGGCCTTTCGAGGTGTTATAGCCTATTATCATACTCTGGATTGGACTGAGGAACGCAGTGAATGCCTTTAGGCAAGATTGCTGGGCGCTTTCGCTAATAAATGTTAGAATTTCTGCTTCGGGTGGTGCTAATGTTTAAAGGAGGAACTCGTTTAGTATATTTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC_FROGS_combined","Species"] <- "Mucor Group racemosus brunneogriseus"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATTCTATACCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCCTAAGCCGC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCCTAAGCCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCCTAAGCCGC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACTTTCAGTGTTCGAGTTGTAATTTGAAGAAGGTAACTTTGGTTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACTTTCAGTGTTCGAGTTGTAATTTGAAGAAGGTAACTTTGGTTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACTTTCAGTGTTCGAGTTGTAATTTGAAGAAGGTAACTTTGGTTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTGATGAGATGCCCAATTCCATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTGATGAGATGCCCAATTCCATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTGATGAGATGCCCAATTCCATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Debaryomyces hansenii"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Family"] <- "Debaryomycetaceae"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Debaryomyces"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATCTTAAGCCAC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCTCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Species"] <- "Geotrichum candidum"
t["AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined","Genus"] <- "Geotrichum"
to_remove <- c("AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTCTCGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAGTGTTTTCCTGACACGCCAGATAAATAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTGAGCTGTTGTCTTTTGTGATACATTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGTTCCCTTCCTTTTTGGTTGGGTTCCTCGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACATTGGAATGTAGCTTTACTTCGGTGAAGTGTTATAGACTTTGTTGATACTGCCTATCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCGTAATGATCTTAAGCCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTAAGGTCAGACTTGGTTTACCAGGCCAGCATCGGTTTAGATGGCAGGATAATGGCGTAGGAATGTGGCTTTGCTTCGGTAAAGTGTTATAGCCTGCGTTGATACTGCCTATTTAGACCGAGGACTGCGTCTTTGACAAGGATGCTGGCATAATGGCCTTAAGCCAC_FROGS_combined",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGGGAGAAAAAACTAGGAGGAATGTAGCCCTTCGGGGTGTTATAGCTTCTTAGAAAATATCCTGGATTGGATTGAGGATCGCAGTGAATGCCTTTAGGCAAGATTGCTGGGCGCTTTTGTTGATAAATGCTAGAATTTCTGCTTCAGGTGGTGCTAGTGTTTAAAGGTGAAACTCGTTTAGTATATTTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC","ATATATGTCCACTGTGTTGTTGGAGAAGAGTTGACAGCGGAGCAATTGGCAGAGGAAAACCAGCTAGACAATAAGCCTCAACAAAGAACTACAGCTCCGGAGGTAATAGGATTCGATCGTCTATTGCAACAGGGATTTTCCCAGGAAGATATCAATGATTTGCGGAGGCAATTTGTTCTGATATATGGAACCAATTTA",
"TGGGGTATGGTCTGCCCCGCAGAAACTCCAGAAGGTCAAGCGTGTGGTTTGGTCAAGAATTTGTCTTTGATGTCGTGTATATCTGTTGGTACTTCATCAGAACCAATTTTGTATTTCTTAGAAGAATGGGGTATGGAACCTTTGGAAGATTATGTACCTTCGAATTCTCCCGATTCAACGAGAGTCTTTGTTAATGGTGTCTGGGTTGGTACTCATAGAGAACCTGCTCATTTGGTTGACACTATGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAATATGTTGATGCAGAAGAAGAAGAAACCATAATGATTGCTATGACTCCAGAAGACTTGGAAACAAGCAGAAGTACTTTATCAGAGACAGAACAGAAGGATATGCAACTTGAAGAACAAGAAGTTGACCCTGCAAAGAGAATCAAGCCTACACTTGGATTACATACGTTTACCCATTGTGAAATCCATCCTTCAATGATTCTAGGAGTTGCAGCCTCTATTATTCCGTTCCCTGATCATAATCAATC_FROGS_combined",
"AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGTTTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCAATTCCATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACATTGGAATGTAGCTTTACTTCGGTGAAGTGTTATAGACTTTGTTGATACTGCCTATCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCGTAATGATCTTAAGCCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"TTGAAAGGGAAACGATTGAAGTCAGTCGCGTCTACTCAGACTCAGCCGTGGTTCTCCACGGTGTACTTCTGTGCAGATGGGCCAGCATCGATTTTGTTTGCCGTACAAAGGTTGGAGGAATGTGGCATTCTTCGGGATGTGTTATAGCCTCTTTCTGTATGCGGTGGATGGGATCGAGGTTCGCAGCGCGCCGCAAGGCTGGGGTTCGCCCACATACGCGCTTAGGATGCTGACGTA",
"AACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC",
"AAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCTTTCAGCGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGCTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAGTCCTATGTAAGGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"TTGAAAGGGAAACGATTGAAGCCAGTCGTACTCATGGGTAATCAACCTTTCTGGCGCGATTATGTGGGCGTGTTGGAGCTTAATCAGCCCTCGCGTTTTTATATTCGTTCCCCTTGGGTGTACTTGCCCGTGCGGTAGGTTAACATCAATTTCGGACGTCATAAAATGACGGGAGGAATGTAGCTTTGGTCTCGTACTGAAGTGTTATAGCCTCTAGTAGATGTGACGTCTGGGATTGAGGATTGCAACGGATACCTCTCGGGGCTACCTGCCTGGTCTCTGATGGTTGCTATGGTGCCGAAAGCTTGCTTACGGTCATCAAAGTTGATTGTCAAAAGGTTAGAACAGGTTAAATTCGTTAAGGATGCTGACGTA",
"AAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGT_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGCGGGCCTTGCCTTCGTGGCGGGGGTCTATCCACAGCTTATCGGGCCAGCATCGGTTTGGACGGCAGGATAATGGCGTAGGAATGTAGCTTCCTCTCGGGGAAGCATTATAGCCTGCGTTGATGCTGCCAGTCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTATTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATGAC",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTGAGCTGTTGTCTTTTGTGATACATTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGTTAAAAGGGAACCGTTTGGAGCCAGATTGGCTTGATTGTAATCAACCTAGAATTCGTTTTGGGTGCACTTGCAGTCTATGCCTGCCAACGACAGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"CACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGTTGTTGTTCAACCATGTTTCGGCATGGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTAGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGGCTTGCTTTCGGGCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGGTGGCAGGATAATAGCATAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTGCCTGCCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCATAATGATCCTAAGCCGC_FROGS_combined",
"AAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCTTAGCTAAACCGGATTGTAAACTGTAGAAACATTTTCCAGATACACTAGACAAAAAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGTCTAAGTAGTTGTCTATTGTGATATGTTTTCAAAGAGTCAGGTTGTTTGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCGTAAGCCGAGTTGTAATTTGAAGATGGCTACTTTGGTAATGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCATTACCGTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCCCCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTTGGCACAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTTGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCGC_FROGS_combined",
"AAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCCTCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGACTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTGACTAGGATGTTGGCATAATGATCTTAAGCCAC_FROGS_combined")
tax_table(physeq_d1d2) <- t
keptTaxa <- setdiff(taxa_names(physeq_d1d2), to_remove)
physeq_d1d2_final <- prune_taxa(keptTaxa, physeq_d1d2)
saveRDS(physeq_d1d2_final,"REAL_CHEESE/D1D2_final.rds")
```
```{r, eval=T}
......
This source diff could not be displayed because it is too large. You can view the blob instead.
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment