Commit 59693191 authored by Olivier Rue's avatar Olivier Rue
Browse files

cheese ITS1 and ITS2 OK

parent b29bff07
Pipeline #43235 passed with stage
in 32 seconds
......@@ -338,6 +338,7 @@ ggVennDiagram(x,label_alpha = 0) +
```
# CHEESE
```{bash, eval=F}
......@@ -539,7 +540,18 @@ ggVennDiagram(x,label_alpha = 0) +
```
### Common species
```{r, eval=T}
x <- list(
ITS1 = as_tibble(tax_table(physeq_its1))$Species %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2))$Species %>% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Species %>% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Species %>% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = "#F4FAFE", high = "#4981BF")
```
......@@ -576,11 +588,47 @@ t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAA
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC","Genus"] <- "Galactomyces"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC","Species"] <- "Galactomyces_sp"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAGTAGATTACTGGGGGAATCGCTGAATATGGCCTGCGCTTAATTGCGCGGCTAATTCTTGATTTTCTGCTATCAGTTTTCTTTCTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAACATTTTGCATTATGAAAAACTATTTATCAAGAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTC","Species"] <- "Kluyveromyces lactis"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACATCAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC","Species"] <- "Geotrichum candidum"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTTATAGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC","Species"] <- "Trichosporon Group faecale insectorum asahii"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAATTAATTTATTACATTGTTTTTGAAGCAAACACTAATAACCATTAATATTCAATAACTTAGAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTC","Species"] <- "Candida sp."
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG","Species"] <- "Penicillium Group fuscoglaucum speluncae commune caseifluvum cavernicola"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTC","Species"] <- "Mucor Group brunneogriseus racemosus"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTCATTGGCTTAAAACTATATCCACATACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC","Species"] <- "Trichosporon Group faecale insectorum asahii"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG","Species"] <- "Penicillium Group chrysogenum tardochrysogenum"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG", "Species"] <- "Penicillium Group flavigenum molle egyptiacum nalgiovense"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTTATAGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTATTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC","Species"] <- "Trichosporon Group faecale insectorum asahii"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCATCTTGGCTTAAAACTATATCCATTAACACCTGTGAACTGTCTGATTGAATCTTTATTGATTCGATTTTACAAACATTGTGTAATGAACGTCATAACATTATAATAAAAAAAAACTTTTAACAACGGATCTCTTGGCTCTC", "Genus"] <- "Apiotrichum"
t["AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCATCTTGGCTTAAAACTATATCCATTAACACCTGTGAACTGTCTGATTGAATCTTTATTGATTCGATTTTACAAACATTGTGTAATGAACGTCATAACATTATAATAAAAAAAAACTTTTAACAACGGATCTCTTGGCTCTC", "Species"] <- "Apiotrichum otae"
to_remove <- c("AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAACGGATCTCTTGGTTCTC_FROGS_combined",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTT_FROGS_combined",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTCTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC_FROGS_combined",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAACAAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC_FROGS_combined",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAACTCATCATATCTTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAAACTCATCATATCATTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTC_FROGS_combined")
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAACTCATCATATCTTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAAACTCATCATATCATTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTC_FROGS_combined",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAATTGCGCGGCGAAAAAACCTTACACACAGTGGTTTTTGTTATTACAAGAACTTTTGCTTTGGTCTGGACTAGAAATAGTTTGGGCCAGAGGTTTACTGAACTAAACTTCAATATTTATATTGAATTGTTATTTATTTAATTGTCAATTTGTTGATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGTATTCTTTTTGCCAGCGCTTAATTGCGCGGCGAAAAAACCTTACACACAGTGTTTTTTGTTATTACAAGAACTTTTGCTTTGGTCTGGACTAGAAATAGTTTGGGCCAGAGGTTTACTGAACTAAACTTCAATATTTATATTGAATTGTTATTTATTTAATTGTCAATTTGTTGATTAAATTCAAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAAAAATACTATAGTCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACAACAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATAAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCGCCCGCCGAAGACACCTATGAACTCTGTCTGAAGATTGCAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTCGGGCTTAAACTATATCCCTAACACCTGTGAACTGTTGATTAACCTTATGGTTAATATTTTTACAAACATTGTGTAATGAACGTCATGTTATAATAACAAATATAACTTTCAACAACGGATCTCTTGGCTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAACGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATAAATATTTGTGAATTTACCACAGCAAACATCAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAAAAATACTATAGTCAAAACAAAAATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"CTTGGTCCTTTCTCTTCCTTCCCCTTCTTCCCCCTTTTTCCTTCTTTTCCCCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC",
"AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAAAAATACTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC"
)
tax_table(physeq_its1) <- t
keptTaxa <- setdiff(taxa_names(physeq_its1), to_remove)
......@@ -589,15 +637,64 @@ saveRDS(physeq_its1_final,"REAL_CHEESE/ITS1_final.rds")
```
```{r, eval=T}
t <- tax_table(physeq_its2)
t["GAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTTTTTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCTTCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTAGGGTCAATGAGCTTATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTAATCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAA","Species"] <- "Kluyveromyces lactis"
t["AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA","Species"] <- "Mucor brunneogriseus"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACTCGCTTTGTAGGCCTGGCCGGCGCTTGCCGATCAACCAAACTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA", "Species"] <- "Penicillium bialowiezense"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_camemberti_caseifulvum_fuscoglaucum_commune"
# Penicillium_Group_Goetzii_rubens ????
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium tularense"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Species"] <- "Wickerhamiella pararugosa"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Genus"] <- "Wickerhamiella"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Family"] <- "Trichomonascaceae"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Order"] <- "Saccharomycetales"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Class"] <- "Saccharomycetes"
t["AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA","Phylum"] <- "Ascomycota"
t["AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTTTTGCAATTGAACTTGTATTGGGGCCTCCCAAATAAATCATTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA","Species"] <- "Mucor brunneogriseus"
to_remove <- c("GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACGACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA",
"GAAACGCGATATTTCTTGTGAATTGCAAAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGTATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"GAAACGCGATATTTCTTGTGAATTGCAGAAGTGTATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"TGGGGTATGGTCTGCCCCGCAGAAACTCCAGAAGGTCAAGCGTGTGGTTTGGTCAAGAATTTGTCTTTGATGTCGTGTATATCTGTTGGTACTTCATCAGAACCAATTTTGTATTTCTTAGAAGAATGGGGTATGGAACCTTTGGAAGATTATGTACCTTCGAATTCTCCCGATTCAACGAGAGTCTTTGTTAATGGTGTCTGGGTTGGTACTCATAGAGAACCTGCTCATTTGGTTGACACTATGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAATATGTTGATGCAGAAGAAGAAGAAACCATAATGATTGCTATGACTCCAGAAGACTTGGAAACAAGCAGAAGTACTTTATCAGAGACAGAACAGAAGGATATGCAACTTGAAGAACAAGAAGTTGACCCTGCAAAGAGAATCAAGCCTACACTTGGATTACATACGTTTACCCATTGTGAAATCCATCCTTCAATGATTCTAGGAGTTGCAGCCTCTATTATTCCTTTCCCTGATCATAATCAGTC",
"TGGGGCATGGTCTGCCCCGCGCGAAGCCGACCAGCAGCACATTCGAGTCACGAAATACCTGCGCGGACCCGAGGTGCCCTGGGCGATCGAAACCGGATGGCACACCGGCGACGGCGATGACTGGCTGCACCGAGGCGGGCTGAAGCTCTTCTCCGACGGAGCCCTGGGCTCGCACACCAGCCACATGTCCTCACCGTTCCCTGATCATAATCAATCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGGGTATGGTCTGCCCTGCGCGAAGCCGACCAGCAGCACATTCGAGTCACGAAATACCTGCGCGGACCCGAGGTGCCCTGGGCGATCGAAACCGGATGGCACACCGGCGACGGCGATGACTGGCTGCACCGAGGCGGGCTGAAGCTCTTCTCCGACGGAGCCCTGGGCTCGCACACCAGCCACATGTCCTCACCGTTCCCTGATCATAATCAGTC",
"GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAAAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAA",
"TGGGGTATGGTCTGCCCCGCAGAAACACCTGAAGGTCAAGCATGTGGTCTTGTTAAGAACTTGTCCTTGATGTCTTGTATTTCTGTTGGTACTGATCCCCTGCCAATTATCACCTTCTTGAATGAATGGGGTATGGAACCGTTAGAAGATTACATACCTCATCAATCTCCAGATGCTACAAGAGTTTTTGTTAACGGTGTCTGGCATGGTATTCACAGAAATCCTGCTAAATTGGTTGATACCATCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGTTGCTCAATGAGGGCCTCGTCGAGTACATCGATGCTGAAGAAGAAGAAACTATTCTAATTGCTATGCAACATGAAGATTTGGATCCAGCTTTACTACCTGTGGCAGACTCTGAAGATGATCTGGATCCAGCCAGACGTATCAGAGCTATACATAATTCAAACATTTTCACACATTGTGAAATTCACCCTTCAATGATTCTTGGTGTAGCTGCTTCTGTTATTCCCTTCCCTGATCATAATCAGTC",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA",
"AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA",
"GAAATGCGAAAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCACGCCCACTTGGGCGTGGTGTTGGGGATCGGCCAAGCCCTATAGACGGGACGCCGGCCCCTAAATCTAGTGGCGGGACCGCTGTGGCCTCCTCTGCGTAGTAGTGATACCCCGCATGTGGAGAGCGGCGAGCCCCTGCCGTTAAACCCCCAACTTTTTCAAGGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAA",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA",
"GCATCTCTTCCTCCCTCCTCTCCCCTCTCTCTTTCTTTTTCCTTTCCTCCGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA",
"AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAA")
tax_table(physeq_its2) <- t
keptTaxa <- setdiff(taxa_names(physeq_its2), to_remove)
physeq_its2_final <- prune_taxa(keptTaxa, physeq_its2)
saveRDS(physeq_its2_final,"REAL_CHEESE/ITS2_final.rds")
```
```{r, eval=T}
if (!file.exists("REAL_CHEESE/cheese_final.rds")){
cheese_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2, physeq_d1d2, physeq_rpb2)
sample_data(cheese_all_final)$Marker <- factor(sample_data(cheese_all_final)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(cheese_all_final,"REAL_CHEESE/cheese_final.rds")
}else{
cheese_all_final <- readRDS("REAL_CHEESE/cheese_final.rds")
}
#if (!file.exists("REAL_CHEESE/cheese_final.rds")){
cheese_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2_final, physeq_d1d2, physeq_rpb2)
sample_data(cheese_all_final)$Marker <- factor(sample_data(cheese_all_final)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(cheese_all_final,"REAL_CHEESE/cheese_final.rds")
#}else{
# cheese_all_final <- readRDS("REAL_CHEESE/cheese_final.rds")
#}
```
......@@ -661,19 +758,26 @@ ggVennDiagram(x,label_alpha = 0) +
```{r, eval=T}
x <- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Genus %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2))$Genus %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Genus %>% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Genus %>% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Genus %>% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = "#F4FAFE", high = "#4981BF")
```
### Common species
```{r, eval=T}
x <- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Species %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Species %>% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Species %>% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Species %>% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = "#F4FAFE", high = "#4981BF")
```
......
......@@ -11,25 +11,17 @@
<meta name="author" content="Olivier Rué" />
<meta name="date" content="2021-10-19" />
<meta name="date" content="2021-10-22" />
<title>Real samples analysis</title>
<script src="real_samples_files/header-attrs-2.6/header-attrs.js"></script>
<script src="real_samples_files/jquery-1.11.3/jquery.min.js"></script>
<meta name="viewport" content="width=device-width, initial-scale=1" />
<link href="real_samples_files/bootstrap-3.3.5/css/bootstrap.min.css" rel="stylesheet" />
<script src="real_samples_files/bootstrap-3.3.5/js/bootstrap.min.js"></script>
<script src="real_samples_files/bootstrap-3.3.5/shim/html5shiv.min.js"></script>
<script src="real_samples_files/bootstrap-3.3.5/shim/respond.min.js"></script>
<style>h1 {font-size: 34px;}
h1.title {font-size: 38px;}
h2 {font-size: 30px;}
h3 {font-size: 24px;}
h4 {font-size: 18px;}
h5 {font-size: 16px;}
h6 {font-size: 12px;}
code {color: inherit; background-color: rgba(0, 0, 0, 0.04);}
pre:not([class]) { background-color: white }</style>
<script src="real_samples_files/jqueryui-1.11.4/jquery-ui.min.js"></script>
<link href="real_samples_files/tocify-1.9.1/jquery.tocify.css" rel="stylesheet" />
<script src="real_samples_files/tocify-1.9.1/jquery.tocify.js"></script>
......@@ -48,6 +40,11 @@
</style>
<style type="text/css">code{white-space: pre;}</style>
<style type="text/css">
pre:not([class]) {
background-color: white;
}
</style>
<script type="text/javascript">
if (window.hljs) {
hljs.configure({languages: []});
......@@ -60,6 +57,32 @@ if (window.hljs) {
<style type="text/css">
h1 {
font-size: 34px;
}
h1.title {
font-size: 38px;
}
h2 {
font-size: 30px;
}
h3 {
font-size: 24px;
}
h4 {
font-size: 18px;
}
h5 {
font-size: 16px;
}
h6 {
font-size: 12px;
}
.table th:not([align]) {
text-align: left;
}
</style>
......@@ -71,6 +94,10 @@ if (window.hljs) {
margin-left: auto;
margin-right: auto;
}
code {
color: inherit;
background-color: rgba(0, 0, 0, 0.04);
}
img {
max-width:100%;
}
......@@ -86,9 +113,6 @@ button.code-folding-btn:focus {
summary {
display: list-item;
}
pre code {
padding: 0;
}
</style>
......@@ -101,6 +125,7 @@ pre code {
max-height: 500px;
min-height: 44px;
overflow-y: auto;
background: white;
border: 1px solid #ddd;
border-radius: 4px;
}
......@@ -229,7 +254,7 @@ div.tocify {
<!-- setup 3col/9col grid for toc_float and main content -->
<div class="row">
<div class="row-fluid">
<div class="col-xs-12 col-sm-4 col-md-3">
<div id="TOC" class="tocify">
</div>
......@@ -240,11 +265,11 @@ div.tocify {
<div id="header">
<div class="fluid-row" id="header">
<div class="btn-group pull-right float-right">
<button type="button" class="btn btn-default btn-xs btn-secondary btn-sm dropdown-toggle" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"><span>Code</span> <span class="caret"></span></button>
<ul class="dropdown-menu dropdown-menu-right" style="min-width: 50px;">
<div class="btn-group pull-right">
<button type="button" class="btn btn-default btn-xs dropdown-toggle" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"><span>Code</span> <span class="caret"></span></button>
<ul class="dropdown-menu" style="min-width: 50px;">
<li><a id="rmd-show-all-code" href="#">Show All Code</a></li>
<li><a id="rmd-hide-all-code" href="#">Hide All Code</a></li>
</ul>
......@@ -254,7 +279,7 @@ div.tocify {
<h1 class="title toc-ignore">Real samples analysis</h1>
<h4 class="author">Olivier Rué</h4>
<h4 class="date">2021-10-19</h4>
<h4 class="date">2021-10-22</h4>
</div>
......@@ -305,7 +330,7 @@ grep -f to_keep.lst affiliation-filtered.tsv &gt;&gt; affiliation-filtered-final
<div id="meat" class="section level1">
<h1>MEAT</h1>
<div id="analysis-of-raw-biom-files" class="section level2 tabset">
<h2>Analysis of raw BIOM files</h2>
<h2 class="tabset">Analysis of raw BIOM files</h2>
<pre class="r"><code>if (!file.exists(&quot;REAL_MEAT/ITS1.rds&quot;)) {
biomfile &lt;- &quot;REAL_MEAT/ITS1.biom&quot;
physeq_its1 &lt;- import_frogs(biomfile, taxMethod = &quot;blast&quot;)
......@@ -370,7 +395,7 @@ if (!file.exists(&quot;REAL_MEAT/RPB2.rds&quot;)) {
meat_all &lt;- readRDS(&quot;REAL_MEAT/meat.rds&quot;)
}</code></pre>
<div id="sequencing-depth" class="section level3 tabset">
<h3>Sequencing depth</h3>
<h3 class="tabset">Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(meat_all) %&gt;% as(&quot;data.frame&quot;) %&gt;%
as_tibble(rownames = &quot;SampleID&quot;) %&gt;%
mutate(Final = sample_sums(meat_all)) %&gt;%
......@@ -430,7 +455,7 @@ ggVennDiagram(x,label_alpha = 0) +
</div>
</div>
<div id="manual-curation" class="section level2 tabset">
<h2>Manual curation</h2>
<h2 class="tabset">Manual curation</h2>
<pre class="r"><code>tax_table(physeq_its1) &lt;- t
keptTaxa &lt;- setdiff(taxa_names(physeq_its1), to_remove)
physeq_its1_final &lt;- prune_taxa(keptTaxa, physeq_its1)
......@@ -443,7 +468,7 @@ saveRDS(physeq_its1_final,&quot;REAL_MEAT/ITS1_final.rds&quot;)</code></pre>
meat_all_final &lt;- readRDS(&quot;REAL_MEAT/meat_final.rds&quot;)
}</code></pre>
<div id="sequencing-depth-1" class="section level3 tabset">
<h3>Sequencing depth</h3>
<h3 class="tabset">Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(meat_all_final) %&gt;% as(&quot;data.frame&quot;) %&gt;%
as_tibble(rownames = &quot;SampleID&quot;) %&gt;%
mutate(Final = sample_sums(meat_all_final)) %&gt;%
......@@ -543,7 +568,7 @@ awk -F&#39;\t&#39; &#39;{print $8}&#39; &lt;(grep -v &quot;^#&quot; final.tsv) &
head -n 1 4.tsv &gt; affiliation-filtered-final.tsv
grep -f to_keep.lst affiliation-filtered.tsv &gt;&gt; affiliation-filtered-final.tsv</code></pre>
<div id="analysis-of-raw-biom-files-1" class="section level2 tabset">
<h2>Analysis of raw BIOM files</h2>
<h2 class="tabset">Analysis of raw BIOM files</h2>
<pre class="r"><code>if (!file.exists(&quot;REAL_CHEESE/ITS1.rds&quot;)) {
biomfile &lt;- &quot;REAL_CHEESE/ITS1.biom&quot;
physeq_its1 &lt;- import_frogs(biomfile, taxMethod = &quot;blast&quot;)
......@@ -608,7 +633,7 @@ if (!file.exists(&quot;REAL_CHEESE/RPB2.rds&quot;)) {
cheese_all &lt;- readRDS(&quot;REAL_CHEESE/cheese.rds&quot;)
}</code></pre>
<div id="sequencing-depth-2" class="section level3 tabset">
<h3>Sequencing depth</h3>
<h3 class="tabset">Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(cheese_all) %&gt;% as(&quot;data.frame&quot;) %&gt;%
as_tibble(rownames = &quot;SampleID&quot;) %&gt;%
mutate(Final = sample_sums(cheese_all)) %&gt;%
......@@ -666,9 +691,21 @@ ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-31-1.png" width="1008" /></p>
</div>
<div id="common-species" class="section level3">
<h3>Common species</h3>
<pre class="r"><code>x &lt;- list(
ITS1 = as_tibble(tax_table(physeq_its1))$Species %&gt;% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2))$Species %&gt;% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Species %&gt;% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Species %&gt;% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-32-1.png" width="1008" /></p>
</div>
</div>
<div id="manual-curation-1" class="section level2 tabset">
<h2>Manual curation</h2>
<h2 class="tabset">Manual curation</h2>
<pre class="r"><code>### ITS1
### Déamrche : tous les Meyerozyma guilliermondii controlés puis éliminés car chimères, pour toutes les séquences abondantes (&gt;200 reads) et dont le %id ou %cov sont &lt;95% check par blast et alignement (contre ASVs proches d&#39;un point de vue taxo mais plus abondantes)
......@@ -684,25 +721,106 @@ t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTAC
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,&quot;Genus&quot;] &lt;- &quot;Galactomyces&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Galactomyces_sp&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAGTAGATTACTGGGGGAATCGCTGAATATGGCCTGCGCTTAATTGCGCGGCTAATTCTTGATTTTCTGCTATCAGTTTTCTTTCTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAACATTTTGCATTATGAAAAACTATTTATCAAGAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Kluyveromyces lactis&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACATCAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Geotrichum candidum&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTTATAGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Trichosporon Group faecale insectorum asahii&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAATTAATTTATTACATTGTTTTTGAAGCAAACACTAATAACCATTAATATTCAATAACTTAGAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Candida sp.&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG&quot;,&quot;Species&quot;] &lt;- &quot;Penicillium Group fuscoglaucum speluncae commune caseifluvum cavernicola&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Mucor Group brunneogriseus racemosus&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTCATTGGCTTAAAACTATATCCACATACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Trichosporon Group faecale insectorum asahii&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG&quot;,&quot;Species&quot;] &lt;- &quot;Penicillium Group chrysogenum tardochrysogenum&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG&quot;, &quot;Species&quot;] &lt;- &quot;Penicillium Group flavigenum molle egyptiacum nalgiovense&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTTATAGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTATTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTC&quot;,&quot;Species&quot;] &lt;- &quot;Trichosporon Group faecale insectorum asahii&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCATCTTGGCTTAAAACTATATCCATTAACACCTGTGAACTGTCTGATTGAATCTTTATTGATTCGATTTTACAAACATTGTGTAATGAACGTCATAACATTATAATAAAAAAAAACTTTTAACAACGGATCTCTTGGCTCTC&quot;, &quot;Genus&quot;] &lt;- &quot;Apiotrichum&quot;
t[&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCATCTTGGCTTAAAACTATATCCATTAACACCTGTGAACTGTCTGATTGAATCTTTATTGATTCGATTTTACAAACATTGTGTAATGAACGTCATAACATTATAATAAAAAAAAACTTTTAACAACGGATCTCTTGGCTCTC&quot;, &quot;Species&quot;] &lt;- &quot;Apiotrichum otae&quot;
to_remove &lt;- c(&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAACGGATCTCTTGGTTCTC_FROGS_combined&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTT_FROGS_combined&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTCTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC_FROGS_combined&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAATTTACCACAACAAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC_FROGS_combined&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAACTCATCATATCTTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAAACTCATCATATCATTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTC_FROGS_combined&quot;)
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAACTCATCATATCTTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTAGAATACTCTTGTGGATATTTAATTACATTAAACTCATCATATCATTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTC_FROGS_combined&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAATTGCGCGGCGAAAAAACCTTACACACAGTGGTTTTTGTTATTACAAGAACTTTTGCTTTGGTCTGGACTAGAAATAGTTTGGGCCAGAGGTTTACTGAACTAAACTTCAATATTTATATTGAATTGTTATTTATTTAATTGTCAATTTGTTGATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGTATTCTTTTTGCCAGCGCTTAATTGCGCGGCGAAAAAACCTTACACACAGTGTTTTTTGTTATTACAAGAACTTTTGCTTTGGTCTGGACTAGAAATAGTTTGGGCCAGAGGTTTACTGAACTAAACTTCAATATTTATATTGAATTGTTATTTATTTAATTGTCAATTTGTTGATTAAATTCAAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAAAAATACTATAGTCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACAACAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATAAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCGCCCGCCGAAGACACCTATGAACTCTGTCTGAAGATTGCAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCG&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTCGGGCTTAAACTATATCCCTAACACCTGTGAACTGTTGATTAACCTTATGGTTAATATTTTTACAAACATTGTGTAATGAACGTCATGTTATAATAACAAATATAACTTTCAACAACGGATCTCTTGGCTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAACGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATAAATATTTGTGAATTTACCACAGCAAACATCAATCATACAATCAATAATTAAAAAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAAAAATACTATAGTCAAAACAAAAATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;CTTGGTCCTTTCTCTTCCTTCCCCTTCTTCCCCCTTTTTCCTTCTTTTCCCCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAATAATATTTGTGAAATTTCAACAAACAACATCAATTTTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;,
&quot;AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTAAAAATATTTGTGAATTTACCACAACAAACAAAAATACTATAGTCTATTATTTTTAATTAAAACTTTTAACAATGGATCTCTTGGTTCTC&quot;
)
tax_table(physeq_its1) &lt;- t
keptTaxa &lt;- setdiff(taxa_names(physeq_its1), to_remove)
physeq_its1_final &lt;- prune_taxa(keptTaxa, physeq_its1)
saveRDS(physeq_its1_final,&quot;REAL_CHEESE/ITS1_final.rds&quot;)</code></pre>
<pre class="r"><code>if (!file.exists(&quot;REAL_CHEESE/cheese_final.rds&quot;)){
cheese_all_final &lt;- merge_phyloseq(physeq_its1_final, physeq_its2, physeq_d1d2, physeq_rpb2)
sample_data(cheese_all_final)$Marker &lt;- factor(sample_data(cheese_all_final)$Marker, levels=c(&quot;ITS1&quot;,&quot;ITS2&quot;,&quot;D1D2&quot;,&quot;RPB2&quot;))
saveRDS(cheese_all_final,&quot;REAL_CHEESE/cheese_final.rds&quot;)
}else{
cheese_all_final &lt;- readRDS(&quot;REAL_CHEESE/cheese_final.rds&quot;)
}</code></pre>
<pre class="r"><code>t &lt;- tax_table(physeq_its2)
t[&quot;GAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTTTTTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCTTCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTAGGGTCAATGAGCTTATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTAATCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Kluyveromyces lactis&quot;
t[&quot;AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Mucor brunneogriseus&quot;
t[&quot;GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACTCGCTTTGTAGGCCTGGCCGGCGCTTGCCGATCAACCAAACTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA&quot;, &quot;Species&quot;] &lt;- &quot;Penicillium bialowiezense&quot;
t[&quot;GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Penicillium_Group_camemberti_caseifulvum_fuscoglaucum_commune&quot;
# Penicillium_Group_Goetzii_rubens ????
t[&quot;GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Penicillium tularense&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Wickerhamiella pararugosa&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Genus&quot;] &lt;- &quot;Wickerhamiella&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Family&quot;] &lt;- &quot;Trichomonascaceae&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Order&quot;] &lt;- &quot;Saccharomycetales&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Class&quot;] &lt;- &quot;Saccharomycetes&quot;
t[&quot;AAAGCGCGATAGATAATGTGAATTGCAGACGTGAATCATTGAGTTTTTGAACGCACATTGCACCTCTTTGGAGGTATACTTGTGTGAGCGTCATTTTTTCTCCACATATATATTAGTGGGTAATGGTTCACTATATGGACTGAAAAAGATTATACACAGTTGTTAGACACAAGCTGTGGAAAATTATCAAATTTTGACCTCATATCAAGTAAGATCACCCGCTGAACTTAA&quot;,&quot;Phylum&quot;] &lt;- &quot;Ascomycota&quot;
t[&quot;AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTTTTGCAATTGAACTTGTATTGGGGCCTCCCAAATAAATCATTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA&quot;,&quot;Species&quot;] &lt;- &quot;Mucor brunneogriseus&quot;
to_remove &lt;- c(&quot;GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACGACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;GAAACGCGATATTTCTTGTGAATTGCAAAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGTATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;GAAACGCGATATTTCTTGTGAATTGCAGAAGTGTATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;TGGGGTATGGTCTGCCCCGCAGAAACTCCAGAAGGTCAAGCGTGTGGTTTGGTCAAGAATTTGTCTTTGATGTCGTGTATATCTGTTGGTACTTCATCAGAACCAATTTTGTATTTCTTAGAAGAATGGGGTATGGAACCTTTGGAAGATTATGTACCTTCGAATTCTCCCGATTCAACGAGAGTCTTTGTTAATGGTGTCTGGGTTGGTACTCATAGAGAACCTGCTCATTTGGTTGACACTATGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAATATGTTGATGCAGAAGAAGAAGAAACCATAATGATTGCTATGACTCCAGAAGACTTGGAAACAAGCAGAAGTACTTTATCAGAGACAGAACAGAAGGATATGCAACTTGAAGAACAAGAAGTTGACCCTGCAAAGAGAATCAAGCCTACACTTGGATTACATACGTTTACCCATTGTGAAATCCATCCTTCAATGATTCTAGGAGTTGCAGCCTCTATTATTCCTTTCCCTGATCATAATCAGTC&quot;,
&quot;TGGGGCATGGTCTGCCCCGCGCGAAGCCGACCAGCAGCACATTCGAGTCACGAAATACCTGCGCGGACCCGAGGTGCCCTGGGCGATCGAAACCGGATGGCACACCGGCGACGGCGATGACTGGCTGCACCGAGGCGGGCTGAAGCTCTTCTCCGACGGAGCCCTGGGCTCGCACACCAGCCACATGTCCTCACCGTTCCCTGATCATAATCAATCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGGGTATGGTCTGCCCTGCGCGAAGCCGACCAGCAGCACATTCGAGTCACGAAATACCTGCGCGGACCCGAGGTGCCCTGGGCGATCGAAACCGGATGGCACACCGGCGACGGCGATGACTGGCTGCACCGAGGCGGGCTGAAGCTCTTCTCCGACGGAGCCCTGGGCTCGCACACCAGCCACATGTCCTCACCGTTCCCTGATCATAATCAGTC&quot;,
&quot;GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAAAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACACCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAA&quot;,
&quot;TGGGGTATGGTCTGCCCCGCAGAAACACCTGAAGGTCAAGCATGTGGTCTTGTTAAGAACTTGTCCTTGATGTCTTGTATTTCTGTTGGTACTGATCCCCTGCCAATTATCACCTTCTTGAATGAATGGGGTATGGAACCGTTAGAAGATTACATACCTCATCAATCTCCAGATGCTACAAGAGTTTTTGTTAACGGTGTCTGGCATGGTATTCACAGAAATCCTGCTAAATTGGTTGATACCATCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGTTGCTCAATGAGGGCCTCGTCGAGTACATCGATGCTGAAGAAGAAGAAACTATTCTAATTGCTATGCAACATGAAGATTTGGATCCAGCTTTACTACCTGTGGCAGACTCTGAAGATGATCTGGATCCAGCCAGACGTATCAGAGCTATACATAATTCAAACATTTTCACACATTGTGAAATTCACCCTTCAATGATTCTTGGTGTAGCTGCTTCTGTTATTCCCTTCCCTGATCATAATCAGTC&quot;,
&quot;GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA&quot;,
&quot;AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAA&quot;,
&quot;GAAATGCGAAAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCACGCCCACTTGGGCGTGGTGTTGGGGATCGGCCAAGCCCTATAGACGGGACGCCGGCCCCTAAATCTAGTGGCGGGACCGCTGTGGCCTCCTCTGCGTAGTAGTGATACCCCGCATGTGGAGAGCGGCGAGCCCCTGCCGTTAAACCCCCAACTTTTTCAAGGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAA&quot;,
&quot;GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA&quot;,
&quot;GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;GCATCTCTTCCTCCCTCCTCTCCCCTCTCTCTTTCTTTTTCCTTTCCTCCGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA&quot;,
&quot;AAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAACCCTTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAA&quot;)
tax_table(physeq_its2) &lt;- t
keptTaxa &lt;- setdiff(taxa_names(physeq_its2), to_remove)
physeq_its2_final &lt;- prune_taxa(keptTaxa, physeq_its2)
saveRDS(physeq_its2_final,&quot;REAL_CHEESE/ITS2_final.rds&quot;)</code></pre>
<pre class="r"><code>#if (!file.exists(&quot;REAL_CHEESE/cheese_final.rds&quot;)){
cheese_all_final &lt;- merge_phyloseq(physeq_its1_final, physeq_its2_final, physeq_d1d2, physeq_rpb2)
sample_data(cheese_all_final)$Marker &lt;- factor(sample_data(cheese_all_final)$Marker, levels=c(&quot;ITS1&quot;,&quot;ITS2&quot;,&quot;D1D2&quot;,&quot;RPB2&quot;))
saveRDS(cheese_all_final,&quot;REAL_CHEESE/cheese_final.rds&quot;)
#}else{
# cheese_all_final &lt;- readRDS(&quot;REAL_CHEESE/cheese_final.rds&quot;)
#}</code></pre>
<div id="sequencing-depth-3" class="section level3 tabset">
<h3>Sequencing depth</h3>
<h3 class="tabset">Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(cheese_all_final) %&gt;% as(&quot;data.frame&quot;) %&gt;%
as_tibble(rownames = &quot;SampleID&quot;) %&gt;%
mutate(Final = sample_sums(cheese_all_final)) %&gt;%
......@@ -713,19 +831,19 @@ ggplot(df %&gt;% pivot_longer(cols = c(Initial, Final), names_to = &quot;Step&qu
facet_grid(~Marker, scales = &quot;free_x&quot;) +
scale_fill_brewer(palette = &quot;Reds&quot;, direction = -1) +
theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-34-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-36-1.png" width="1008" /></p>
</div>
<div id="compositions-3" class="section level3">
<h3>Compositions</h3>
<pre class="r"><code>p &lt;- plot_composition(physeq = cheese_all_final, taxaRank1 = &quot;Kingdom&quot;, taxaSet1 = &quot;Fungi&quot;, taxaRank2 = &quot;Species&quot;, numberOfTaxa = 22, x = &quot;Sample&quot;)
p + facet_grid(&quot;. ~ Marker&quot;, scales = &quot;free_x&quot;, space = &quot;free&quot;)</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-35-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-37-1.png" width="1008" /></p>
</div>
<div id="richness-3" class="section level3">
<h3>Richness</h3>
<pre class="r"><code>p &lt;- plot_richness(physeq = cheese_all_final, x = &quot;Marker&quot;, color = &quot;Marker&quot;, shape = NULL, title = &quot;Alpha diversity graphics&quot;, measures = c(&quot;Observed&quot;, &quot;Chao1&quot;, &quot;ACE&quot;, &quot;Shannon&quot;, &quot;Simpson&quot;, &quot;InvSimpson&quot;, &quot;Fisher&quot;))
p + geom_boxplot() + NULL</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-36-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-38-1.png" width="1008" /></p>
</div>
<div id="beta-diversity-3" class="section level3">
<h3><span class="math inline">\(\beta\)</span> diversity</h3>
......@@ -734,7 +852,7 @@ ord &lt;- ordinate(cheese_all_final, method = &quot;MDS&quot;, distance = beta.d
p &lt;- plot_ordination(physeq = cheese_all_final, ordination = ord, type = &quot;samples&quot;, axes = c(1, 2), color = &quot;Marker&quot;, shape = NULL, label = NULL, title = &quot;Samples ordination graphic, bray-curtis distance&quot;)
p &lt;- p + stat_ellipse(aes_string(group = &quot;Marker&quot;))
p + theme_bw()</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-37-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-39-1.png" width="1008" /></p>
</div>
<div id="common-families-3" class="section level3">
<h3>Common families</h3>
......@@ -746,19 +864,31 @@ p + theme_bw()</code></pre>
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-38-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-40-1.png" width="1008" /></p>
</div>
<div id="common-genus-3" class="section level3">
<h3>Common genus</h3>
<pre class="r"><code>x &lt;- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Genus %&gt;% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2))$Genus %&gt;% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Genus %&gt;% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Genus %&gt;% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Genus %&gt;% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-39-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-41-1.png" width="1008" /></p>
</div>
<div id="common-species-1" class="section level3">
<h3>Common species</h3>
<pre class="r"><code>x &lt;- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Species %&gt;% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Species %&gt;% as.vector(),
D1D2 = as_tibble(tax_table(physeq_d1d2))$Species %&gt;% as.vector(),
RPB2 = as_tibble(tax_table(physeq_rpb2))$Species %&gt;% as.vector()
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-42-1.png" width="1008" /></p>
</div>
</div>
</div>
......@@ -779,7 +909,7 @@ scp orue@genologin.toulouse.inra.fr:/work/frogsfungi/FungiPubli/Real_mock/METABA
#scp orue@genologin.toulouse.inra.fr:/work/frogsfungi/FungiPubli/Real_mock/METABARFOOD/CHEESE_REAL/results/DADA2_FROGS/D1D2/multiaff.tsv REAL_CHEESE/D1D2_multiaff.tsv
#scp orue@genologin.toulouse.inra.fr:/work/frogsfungi/FungiPubli/Real_mock/METABARFOOD/CHEESE_REAL/results/DADA2_FROGS/RPB2/multiaff.tsv REAL_CHEESE/RPB2_multiaff.tsv</code></pre>
<div id="analysis-of-raw-biom-files-2" class="section level2 tabset">
<h2>Analysis of raw BIOM files</h2>
<h2 class="tabset">Analysis of raw BIOM files</h2>
<pre class="r"><code>if (!file.exists(&quot;REAL_BREAD/ITS1.rds&quot;)) {
biomfile &lt;- &quot;REAL_BREAD/ITS1.biom&quot;
physeq_its1 &lt;- import_frogs(biomfile, taxMethod = &quot;blast&quot;)
......@@ -844,7 +974,7 @@ if (!file.exists(&quot;REAL_BREAD/RPB2.rds&quot;)) {
bread_all &lt;- readRDS(&quot;REAL_BREAD/bread.rds&quot;)
}</code></pre>
<div id="sequencing-depth-4" class="section level3 tabset">
<h3>Sequencing depth</h3>
<h3 class="tabset">Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(bread_all) %&gt;% as(&quot;data.frame&quot;) %&gt;%
as_tibble(rownames = &quot;SampleID&quot;) %&gt;%
mutate(Final = sample_sums(bread_all)) %&gt;%
......@@ -855,19 +985,19 @@ ggplot(df %&gt;% pivot_longer(cols = c(Initial, Final), names_to = &quot;Step&qu
facet_grid(~Marker, scales = &quot;free_x&quot;) +
scale_fill_brewer(palette = &quot;Reds&quot;, direction = -1) +
theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-43-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-46-1.png" width="1008" /></p>
</div>
<div id="compositions-4" class="section level3">
<h3>Compositions</h3>
<pre class="r"><code>p &lt;- plot_composition(physeq = bread_all, taxaRank1 = &quot;Kingdom&quot;, taxaSet1 = &quot;Fungi&quot;, taxaRank2 = &quot;Species&quot;, numberOfTaxa = 22, x = &quot;Sample&quot;)
p + facet_grid(&quot;. ~ Marker&quot;, scales = &quot;free_x&quot;, space = &quot;free&quot;)</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-44-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-47-1.png" width="1008" /></p>
</div>
<div id="richness-4" class="section level3">
<h3>Richness</h3>
<pre class="r"><code>p &lt;- plot_richness(physeq = bread_all, x = &quot;Marker&quot;, color = &quot;Marker&quot;, shape = NULL, title = &quot;Alpha diversity graphics&quot;, measures = c(&quot;Observed&quot;, &quot;Chao1&quot;, &quot;ACE&quot;, &quot;Shannon&quot;, &quot;Simpson&quot;, &quot;InvSimpson&quot;, &quot;Fisher&quot;))
p + geom_boxplot() + NULL</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-45-1.png" width="1008" /></p>
<p><img src="real_samples_files/figure-html/unnamed-chunk-48-1.png" width="1008" /></p>
</div>