Commit 13ee9457 authored by Olivier Rue's avatar Olivier Rue
Browse files

curation

parent 1477125a
Pipeline #45011 passed with stage
in 24 seconds
......@@ -464,7 +464,7 @@ curation_meat_its1 <- function(phyloseq){
t <- tax_table(phyloseq)
to_remove <- c("")
tax_table(phyloseq) <- t
keptTaxa <- setdiff(taxa_names(phyloseq), to_remove)
phyloseq_curated <- prune_taxa(keptTaxa, phyloseq)
......@@ -474,8 +474,74 @@ curation_meat_its1 <- function(phyloseq){
curation_meat_its2 <- function(phyloseq){
t <- tax_table(phyloseq)
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_fimorum_robsamsonii_polonicum_hirsutum_albocoremium_viridicatum_italicum_resticulosum_tricolor_expansum_marinum_compactum_concentricum"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_fabryi_coudertii_psychrosporus_vindobonensis_prosopidis_renaii_subglobosus"
t["GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCGAGCGCGGCTAGCCCTACGGGGCCTGCCGCCGCCCGGTGTTGGGGCTCTACGGGTGGGGTTCGTCCCCCCCGCAGTCCCCGAAATGTAGTGGCGGTCCAGCCGCGGCGCCCCCTGCGTAGTAGATCCTACATCTCGCATCGGGTCCCGGCGAAGGCCAGCCGTCGAACCTTCTTACTCATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAA","Species"] <- "Scopulariopsis_Group_fusca_candida"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_coudertii_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus_renaii"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGATCAACCACACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium tularense"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium_mononematosium_atramentosum"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium bovifimosum"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_psychrosporus"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCGAGCGCGGCTAGCCCTACGGGGCCTGCCGCCGCCCGGTGTTGGGGCTCTACGGGTGGGGTTCGTCCCCCCCGCAGTCCCCGAAATGTAGTGGCGGTCCAGCCGCGGCGCCCCCTGCGTAGTAGATCCTACATCTCGCATCGGGTCCCGGCGAAGGCCAGCCGTCGAACCTTCTTACTCATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAA","Species"] <- "Scopulariopsis_Group_fusca_candida"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_raistrickii_lanosum_kojigenum"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_turbatum_caprifimosum"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCGAGCGCGGCTAGCCCTACGGGGCCTGCCGCCGCCCGGTGTTGGGGCTCTACGGGTGGGGTTCGTCCCCCCCGCAGTCCCCGAAATGTAGTGGCGGTCCAGCCGCGGCGCCCCCTGCGTAGTAGATCCTACATCTCGCATCGGGTCCCGGCGAAGGCCAGCCGTCGAACCTTCTTACTCATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAA","Species"] <- "Scopulariopsis_Group_fusca_candida"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_salamii_astrolabium"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium_atramentosum"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_fabryi_coudertii_psychrosporus_vindobonensis_prosopidis_renaii_subglobosus"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_fimorum_robsamsonii_polonicum_hirsutum_albocoremium_viridicatum_italicum_resticulosum_tricolor_expansum_marinum_compactum_concentricum"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium_atramentosum"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_psychrosporus_hansenii"
t["GAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_coudertii_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus_renaii"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_raistrickii_lanosum_kojigenum"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCCGGAATACCAGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_vindobonensis_prosopidis_fabryi_subglobosus"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces psychrosporus"
t["GAAATGCGATACGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_fabryi_coudertii_psychrosporus_vindobonensis_prosopidis_renaii_subglobosus"
t["GAAATGCGATAAGTAATATGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGTAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Aspergillus_Group_ruber_glaucus_pseudoglaucus_mallochii_apendiculatus_cibarius_appendiculatus_tuberculatum"
t["GAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGTAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Genus"] <- "Aspergillus"
t["GAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGTAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Family"] <- "Aspergillaceae"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAATGCGATAAGTAATATGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_fimorum_robsamsonii_polonicum_hirsutum_albocoremium_viridicatum_italicum_resticulosum_tricolor_expansum_marinum_compactum_concentricum"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Penicillium_Group_raistrickii_lanosum_kojigenum"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus"
t["GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined","Species"] <- "Penicillium_Group_nalgiovense_melanoconidium"
t["GAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA","Species"] <- "Geotrichum silvicola"
t["GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_hansenii_psychrosporus"
t["GAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus"
t["GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA","Species"] <- "Debaryomyces_Group_vindobensis_subglobosus_prosopidis_fabryi_psychrosporus"
to_remove <- c("GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"ATCGTCTCCTCACTGTCGGACATGCTCAAGGTGCCGGGAACCGATGTACGCGAACGCGTCGGAGATCTGATGA",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTGTCCTCCATCCCCGGGGGACAGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGATCAACCACACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGTCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"TTTCCCTACACGACGCTCTTCCGATCTGCATCGATGAAGATCGGAAGAGCGTCGTGTAGGAAAG",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA_FROGS_combined",
"GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTTAGTTGAACTAGGCGTTTGCTTGAAATGTATTGGCATGAGTGGTACTGGATAGTGCTATATGACTTTCAATGTATTAGGTTTATCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTCTAGGCTCGGCCTTACAATATAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA_FROGS_combined",
"TGGGGTATGGTATGTCCTGCAGAAACTCCAGAAGGTCAAGCGTGTGGTTTGGTCAAGAATTTGTCTTTGATGTCGTGTATATCTGTTGGTACTTCATCAGAACCAATATTGTATTTCTTAGAAGAATGGGGTATGGAACCTTTGGAAGATTATGTACCATCAAATTCTCCAGATTCAACGAGAGTTTTTGTTAACGGTGTCTGGGTTGGTACTCATAGAGAACCTGCTCATTTGGTTGACACTATGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAATATGTTGATGCAGAAGAAGAAGAAACCATAATGATTGCTATGACTCCAGAAGACTTGGAAACAAGCAGAAGTACTTTATCAGAGACAGAACAGAAGGATATGCAACTTGAAGAACAAGAAGTTGACCCTGCAAAGAGAATCAAGCCTACACTTGGATTACATACGTTTACCCATTGTGAAATCCATCCTTCAATGATTCTAGGAGTTGCAGCCTCTATTATTCCTTTCCCTGATCATAACCAGTC_FROGS_combined",
"GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined",
"TGGGGTATGGTTTGTCCTGCAGAAACTCCTGAAGGTCAAGCTTGTGGGTTGGTTAAAAACTTATCATTAATGTCGTGTATTTCCGTTGGTACGGACCCAATGCCCATTATCACCTTCTTGAGTGAATGGGGTATGGAACCCTTAGAAGATTATATTCCACATCAATCTCCAGAGGCAACAAGAGTCTTTGTTAACGGTGTATGGCATGGTGTCCATAGAAATCCAGCTAGATTAATGGAAACCCTGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCTCGTTGTTAAACGATGGTTTGGTGGAATACATTGATGCAGAAGAAGAGGAAACAATTTTAATTTCTATGCAACCAGAAGATTTAGAACCCGTACAAGAAAATACTTTTAATGAAGACGATGACGATTTGGCAAGACGTATAAAGGCGACTCACCATGCTACGACTTTTACACACTGTGAAGTTCACCCATCTATGATTCTTGGTGTGGCTGCATCTATTATTCCGTTCCCTGACCATAATCAGTC_FROGS_combined",
"TCTGGTTCTCCCAGTGCTTTGCAGTTTGCTGTCTGTGGTCTCCAAAGTGTTTA",
"GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGAGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGAACGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
tax_table(phyloseq) <- t
keptTaxa <- setdiff(taxa_names(phyloseq), to_remove)
phyloseq_curated <- prune_taxa(keptTaxa, phyloseq)
......@@ -486,7 +552,7 @@ curation_meat_d1d2 <- function(phyloseq){
t <- tax_table(phyloseq)
to_remove <- c("")
tax_table(phyloseq) <- t
keptTaxa <- setdiff(taxa_names(phyloseq), to_remove)
phyloseq_curated <- prune_taxa(keptTaxa, phyloseq)
......@@ -497,7 +563,7 @@ curation_meat_rpb2 <- function(phyloseq){
t <- tax_table(phyloseq)
to_remove <- c("")
tax_table(phyloseq) <- t
keptTaxa <- setdiff(taxa_names(phyloseq), to_remove)
phyloseq_curated <- prune_taxa(keptTaxa, phyloseq)
......
......@@ -85,12 +85,15 @@ otu_filters.py --input-biom affiliation.biom --input-fasta filters.fasta --conta
otu_filters.py --input-biom 1.biom --input-fasta 1.fasta --contaminant /db/frogs_databanks/assignation/SILVA_132_LSU/SILVA_132_LSU.fasta --nb-cpus 4 --output-biom 2.biom --output-fasta 2.fasta
otu_filters.py --input-biom 2.biom --input-fasta 2.fasta --contaminant /db/frogs_databanks/assignation/silva_138_SSU/silva_138_SSU.fasta --nb-cpus 4 --output-biom 3.biom --output-fasta 3.fasta
otu_filters.py --input-biom 3.biom --input-fasta 3.fasta --contaminant /db/frogs_databanks/assignation/Unite_Euka_8.2_20200204/Unite_Euka_8.2_20200204.fasta --output-biom 4.biom --output-fasta 4.fasta --nb-cpus 4
biom_to_tsv.py --input-biom 4.biom --output-tsv 4.tsv
biom_to_tsv.py --input-biom 4.biom --output-tsv 4.tsv --input-fasta 4.fasta
head -n 1 4.tsv > 4-2.tsv
sed "s/no data/NA;NA;NA;NA;NA;NA;NA/" 4.tsv |sed "s/no data/0/g" | grep 'FROGS_combined' >> 4-2.tsv
tsv_to_biom.py --input-tsv 4-2.tsv --output-biom 4-2.biom
affiliation_filters.py --input-fasta 4.fasta --input-biom 4-2.biom --min-blast-identity 0.1 --delete
tsv_to_biom.py --input-tsv 4-2.tsv --output-biom 4-2.biom --output-fasta 4-2.fasta
affiliation_filters.py --input-fasta 4-2.fasta --input-biom 4-2.biom --min-blast-identity 0.1 --delete
biom_to_tsv.py --input-biom affiliation-filtered.biom --output-tsv affiliation-filtered.tsv
affiliation_OTU.py --input-fasta affiliation-filtered.fasta --input-biom affiliation-filtered.biom --nb-cpus 8 --output-biom affiliation.biom --summary affiliation.html --reference D1D2.fasta
biom_to_tsv.py --input-biom affiliation.biom --output-tsv affiliation.tsv
......@@ -254,29 +257,37 @@ ggVennDiagram(x,label_alpha = 0) +
## Manual curation {.tabset}
```{r, eval=F}
tax_table(physeq_its1) <- t
keptTaxa <- setdiff(taxa_names(physeq_its1), to_remove)
physeq_its1_final <- prune_taxa(keptTaxa, physeq_its1)
```{r, eval=T}
physeq_its1_final <- curation_meat_its1(physeq_its1)
saveRDS(physeq_its1_final,"REAL_MEAT/ITS1_final.rds")
physeq_its2_final <- curation_meat_its2(physeq_its2)
saveRDS(physeq_its2_final,"REAL_MEAT/ITS2_final.rds")
physeq_d1d2_final <- curation_meat_d1d2(physeq_d1d2)
saveRDS(physeq_d1d2_final,"REAL_MEAT/D1D2_final.rds")
physeq_rpb2_final <- curation_meat_rpb2(physeq_rpb2)
saveRDS(physeq_rpb2_final,"REAL_MEAT/RPB2_final.rds")
```
```{r, eval=F}
if (!file.exists("REAL_MEAT/meat_final.rds")){
meat_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2, physeq_d1d2, physeq_rpb2)
sample_data(meat_all_final)$Marker <- factor(sample_data(meat_all_final)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(meat_all_final,"REAL_MEAT/meat_final.rds")
}else{
meat_all_final <- readRDS("REAL_MEAT/meat_final.rds")
}
```{r, eval=T}
#if (!file.exists("REAL_MEAT/meat_final.rds")){
meat_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2_final, physeq_d1d2_final, physeq_rpb2_final)
sample_data(meat_all_final)$Marker <- factor(sample_data(meat_all_final)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(meat_all_final,"REAL_CHEESE/meat_final.rds")
#}else{
# meat_all_final <- readRDS("REAL_MEAT/meat_final.rds")
#}
```
### Sequencing depth {.tabset}
```{r, eval=F}
```{r, eval=T}
df <- sample_data(meat_all_final) %>% as("data.frame") %>%
as_tibble(rownames = "SampleID") %>%
mutate(Final = sample_sums(meat_all_final)) %>%
......@@ -293,7 +304,7 @@ ggplot(df %>% pivot_longer(cols = c(Initial, Final), names_to = "Step", values_t
### Compositions
```{r, eval=F}
```{r, eval=T}
p <- plot_composition(physeq = meat_all_final, taxaRank1 = "Kingdom", taxaSet1 = "Fungi", taxaRank2 = "Species", numberOfTaxa = 22, x = "Sample")
p + facet_grid(". ~ Marker", scales = "free_x", space = "free")
......@@ -301,14 +312,14 @@ p + facet_grid(". ~ Marker", scales = "free_x", space = "free")
### Richness
```{r, eval=F}
```{r, eval=T}
p <- plot_richness(physeq = meat_all_final, x = "Marker", color = "Marker", shape = NULL, title = "Alpha diversity graphics", measures = c("Observed", "Chao1", "ACE", "Shannon", "Simpson", "InvSimpson", "Fisher"))
p + geom_boxplot() + NULL
```
### $\beta$ diversity
```{r, eval=F}
```{r, eval=T}
beta.dist <- distance(meat_all_final, method = "bray")
ord <- ordinate(meat_all_final, method = "MDS", distance = beta.dist)
p <- plot_ordination(physeq = meat_all_final, ordination = ord, type = "samples", axes = c(1, 2), color = "Marker", shape = NULL, label = NULL, title = "Samples ordination graphic, bray-curtis distance")
......@@ -318,7 +329,7 @@ p + theme_bw()
### Common families
```{r, eval=F}
```{r, eval=T}
x <- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Family %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Family %>% as.vector(),
......@@ -331,7 +342,7 @@ ggVennDiagram(x,label_alpha = 0) +
### Common genus
```{r, eval=F}
```{r, eval=T}
x <- list(
ITS1 = as_tibble(tax_table(physeq_its1_final))$Genus %>% as.vector(),
ITS2 = as_tibble(tax_table(physeq_its2_final))$Genus %>% as.vector(),
......
......@@ -11,7 +11,7 @@
<meta name="author" content="Olivier Rué" />
<meta name="date" content="2021-11-16" />
<meta name="date" content="2021-11-22" />
<title>Real samples analysis</title>
......@@ -254,7 +254,7 @@ div.tocify {
<h1 class="title toc-ignore">Real samples analysis</h1>
<h4 class="author">Olivier Rué</h4>
<h4 class="date">2021-11-16</h4>
<h4 class="date">2021-11-22</h4>
</div>
......@@ -432,17 +432,24 @@ ggVennDiagram(x,label_alpha = 0) +
</div>
<div id="manual-curation" class="section level2 tabset">
<h2>Manual curation</h2>
<pre class="r"><code>tax_table(physeq_its1) &lt;- t
keptTaxa &lt;- setdiff(taxa_names(physeq_its1), to_remove)
physeq_its1_final &lt;- prune_taxa(keptTaxa, physeq_its1)
saveRDS(physeq_its1_final,&quot;REAL_MEAT/ITS1_final.rds&quot;)</code></pre>
<pre class="r"><code>if (!file.exists(&quot;REAL_MEAT/meat_final.rds&quot;)){
meat_all_final &lt;- merge_phyloseq(physeq_its1_final, physeq_its2, physeq_d1d2, physeq_rpb2)
sample_data(meat_all_final)$Marker &lt;- factor(sample_data(meat_all_final)$Marker, levels=c(&quot;ITS1&quot;,&quot;ITS2&quot;,&quot;D1D2&quot;,&quot;RPB2&quot;))
saveRDS(meat_all_final,&quot;REAL_MEAT/meat_final.rds&quot;)
}else{
meat_all_final &lt;- readRDS(&quot;REAL_MEAT/meat_final.rds&quot;)
}</code></pre>
<pre class="r"><code>physeq_its1_final &lt;- curation_meat_its1(physeq_its1)
saveRDS(physeq_its1_final,&quot;REAL_MEAT/ITS1_final.rds&quot;)
physeq_its2_final &lt;- curation_meat_its2(physeq_its2)
saveRDS(physeq_its2_final,&quot;REAL_MEAT/ITS2_final.rds&quot;)
physeq_d1d2_final &lt;- curation_meat_d1d2(physeq_d1d2)
saveRDS(physeq_d1d2_final,&quot;REAL_MEAT/D1D2_final.rds&quot;)
physeq_rpb2_final &lt;- curation_meat_rpb2(physeq_rpb2)
saveRDS(physeq_rpb2_final,&quot;REAL_MEAT/RPB2_final.rds&quot;)</code></pre>
<pre class="r"><code>#if (!file.exists(&quot;REAL_MEAT/meat_final.rds&quot;)){
meat_all_final &lt;- merge_phyloseq(physeq_its1_final, physeq_its2_final, physeq_d1d2_final, physeq_rpb2_final)
sample_data(meat_all_final)$Marker &lt;- factor(sample_data(meat_all_final)$Marker, levels=c(&quot;ITS1&quot;,&quot;ITS2&quot;,&quot;D1D2&quot;,&quot;RPB2&quot;))
saveRDS(meat_all_final,&quot;REAL_CHEESE/meat_final.rds&quot;)
#}else{
# meat_all_final &lt;- readRDS(&quot;REAL_MEAT/meat_final.rds&quot;)
#}</code></pre>
<div id="sequencing-depth-1" class="section level3 tabset">
<h3>Sequencing depth</h3>
<pre class="r"><code>df &lt;- sample_data(meat_all_final) %&gt;% as(&quot;data.frame&quot;) %&gt;%
......@@ -455,16 +462,19 @@ ggplot(df %&gt;% pivot_longer(cols = c(Initial, Final), names_to = &quot;Step&qu
facet_grid(~Marker, scales = &quot;free_x&quot;) +
scale_fill_brewer(palette = &quot;Reds&quot;, direction = -1) +
theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-16-1.png" width="1008" /></p>
</div>
<div id="compositions-1" class="section level3">
<h3>Compositions</h3>
<pre class="r"><code>p &lt;- plot_composition(physeq = meat_all_final, taxaRank1 = &quot;Kingdom&quot;, taxaSet1 = &quot;Fungi&quot;, taxaRank2 = &quot;Species&quot;, numberOfTaxa = 22, x = &quot;Sample&quot;)
p + facet_grid(&quot;. ~ Marker&quot;, scales = &quot;free_x&quot;, space = &quot;free&quot;)</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-17-1.png" width="1008" /></p>
</div>
<div id="richness-1" class="section level3">
<h3>Richness</h3>
<pre class="r"><code>p &lt;- plot_richness(physeq = meat_all_final, x = &quot;Marker&quot;, color = &quot;Marker&quot;, shape = NULL, title = &quot;Alpha diversity graphics&quot;, measures = c(&quot;Observed&quot;, &quot;Chao1&quot;, &quot;ACE&quot;, &quot;Shannon&quot;, &quot;Simpson&quot;, &quot;InvSimpson&quot;, &quot;Fisher&quot;))
p + geom_boxplot() + NULL</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-18-1.png" width="1008" /></p>
</div>
<div id="beta-diversity-1" class="section level3">
<h3><span class="math inline">\(\beta\)</span> diversity</h3>
......@@ -473,6 +483,7 @@ ord &lt;- ordinate(meat_all_final, method = &quot;MDS&quot;, distance = beta.dis
p &lt;- plot_ordination(physeq = meat_all_final, ordination = ord, type = &quot;samples&quot;, axes = c(1, 2), color = &quot;Marker&quot;, shape = NULL, label = NULL, title = &quot;Samples ordination graphic, bray-curtis distance&quot;)
p &lt;- p + stat_ellipse(aes_string(group = &quot;Marker&quot;))
p + theme_bw()</code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-19-1.png" width="1008" /></p>
</div>
<div id="common-families-1" class="section level3">
<h3>Common families</h3>
......@@ -484,6 +495,7 @@ p + theme_bw()</code></pre>
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-20-1.png" width="1008" /></p>
</div>
<div id="common-genus-1" class="section level3">
<h3>Common genus</h3>
......@@ -495,6 +507,7 @@ ggVennDiagram(x,label_alpha = 0) +
)
ggVennDiagram(x,label_alpha = 0) +
scale_fill_gradient(low = &quot;#F4FAFE&quot;, high = &quot;#4981BF&quot;) </code></pre>
<p><img src="real_samples_files/figure-html/unnamed-chunk-21-1.png" width="1008" /></p>
</div>
</div>
</div>
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment