Commit 00af4935 authored by Olivier Rue's avatar Olivier Rue
Browse files

real samples analysis

parent 1305af2c
Pipeline #48203 passed with stage
in 16 seconds
No preview for this file type
No preview for this file type
No preview for this file type
No preview for this file type
No preview for this file type
No preview for this file type
Eco Sample
echantillon1-1 BREAD S1
echantillon1-2 BREAD S1
echantillon1-3 BREAD S1
echantillon2-1 BREAD S2
echantillon2-2 BREAD S2
echantillon2-3 BREAD S2
echantillon3-1 BREAD S3
echantillon3-2 BREAD S3
echantillon3-3 BREAD S3
\ No newline at end of file
Eco SampleID
echantillon1-1 WINE echantillon1-1
echantillon1-2 WINE echantillon1-2
echantillon1-3 WINE echantillon1-3
echantillon2-1 WINE echantillon2-1
echantillon2-2 WINE echantillon2-2
echantillon2-3 WINE echantillon2-3
echantillon3-1 WINE echantillon3-1
echantillon3-2 WINE echantillon3-2
echantillon3-3 WINE echantillon3-3
\ No newline at end of file
No preview for this file type
......@@ -1327,11 +1327,85 @@ curation_wine_its2 <- function(phyloseq){
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Pichiaceae;Pichia;Pichia manshurica","GAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGAACTTTTGTTAAAGAAAGATCCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAATATATCATTGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Trichomonascaceae;Wickerhamiella;Wickerhamiella azyma","AAAGCGCGAAAGATAATGTGAATTGCAGACGTGAATCATTGAGTTGTTGAACGCACATTGCACTTTTCTTAACGGAAAAGTATGCTCTGGCGAGCGTCATTTCTCTCTCCACACCTAGTGGGTATTGAGGCTTTACAAAGCCTTTAAAAAGATCATGCGTATGTGTTAACCACAATGTGCGCTTTAAAATCTAATTTTGACCTCGTCTAGAGCAAGAGTACCCGCTGAACTTAA")
### TO BE CONTINUED
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae;Alternaria;Alternaria_Group_angustiovoidea_destruens","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymosphaeriaceae;unknown_genus;unknown_species","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCGCCTTTGCGCGTGGACTCGCCCCAAATTCATTGGCAGCGGTCCTTGCCTCCTCTCGCGCAGCACATTGCGCTTCTCGAGGTGCGCGGCCCGCGTCCACGAAGCAACATTACCGTCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae;Cryptococcus;Cryptococcus_Group_wingfieldii_amylolentus","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAACATCTCAATCCTTCGGGTTTATGACCTGTTGGCATTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGACGTAATAAGTTTCGTTGGGCCTATGGGGTAGTTGTCGGCTTGCTTATAACAACCATCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_sclerotioniger_carbonarius","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACAACTCCAACCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae;Talaromyces;Talaromyces calidominioluteus","GAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCGTGGTCCCCCCGGTTTCGGGGGGGACCTGCCCGAAAGGCAGCGGCGACGTTCCGCCTAGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGGGAGGGGCCTACGGGCGTTGGCCATCCACCCATTTTTTTACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Botryosphaeriales;Botryosphaeriaceae;Diplodia;Diplodia pseudoseriata","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCGCCGTCCTCTCTGCGGACGCGCCTTAAAGACCTCGGCGGTGGCTGTTCAGCCCTCAAGCGTAGTAGAATACACCTCGCTTTGGAGCGGTTGGCGTCGCCCGCCGGACGAACCTTCTGAACTTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Sordariomycetes;Diaporthales;Diaporthaceae;Diaporthe;Diaporthe hungariae","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCTCCCCCCCCGGGGAGCAGGCCCTGAAATCCAGTGGCGAGCTCGCCAGGACCCCGAGCGCAGTAGTTAAACCCTCGCTCCGGGAGGCCCTGGCGGTGCCCTGCCGTTAAACCCCCAACTTCTGAAAGTTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_allicinum_antarticum_variabile_tenellum","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium_Group_patens_yezoense_Thomii_lapidosum_cartierense_bussumense_fusisporum_glabrum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCCGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACAACCAATCATCCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_shanxiensis_sinensis_fructicola","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCATAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAGCCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATGTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATGTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_sclerotioniger_carbonarius","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACAACTCCAACCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium Group_patens_yezoense_Thomii_lapidosum_cartierense_bussumense_fusisporum_glabrum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCCGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACAACCAATCATCCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Sordariomycetes;Diaporthales;Valsaceae;Cytospora;Cytospora sp.","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTAGCTTGGTGTTGGGGCATTACCTTCTTTTACAGAGGGTAAGCCCTGAAATTCAGTGGCGAGCTCGCCAGGACTCCGAGCGCAGTAGTGTAAACCTCGCTTTGGATAGTACTGGCGCGGCCCTGCCGTAAAACCCCCAACTTCTGAAAATTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATGTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_shanxiensis_sinensis_fructicola","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAACCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae;Alternaria;Alternaria_Group_arbusti_forlicesenensis_metachromatica_oregonensis_poaceicola_ventricosa","GAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTGTCTCCAGTTCGCTGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTTTGCCAGCCAAGGTCAGCGTCCAGCAAGCCTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium angulare","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGTCGACCCCCAATCTATTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_shanxiensis_sinensis_fructicola","GAAATGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAGCCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_pulcherrima_chrysoperlae","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCTGGTTTGGTCCTGCTTCGGCATAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi; Ascomycota; Dothideomycetes; Pleosporales; Lophiostomataceae;Lophiostoma carpini","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTACAAATTCAAGCTCAGCTTGGTGATGGGTGTCTGTCCCGCCTTTGCGTGTGGACTCGCCTCAAATGCAGTTGGCAGCTTGTTCCTCGGCTCTAAACGCAGCAGATTTGCGTCGAGCGTCGTGCGGACGGGCTCTCCAGTAAGCAAACCCCACAAATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_shanxiensis_sinensis_fructicola","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAATCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_pulcherrima_chrysoperlae","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGTCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Sordariomycetes;Hypocreales;Nectriaceae;Fusarium;Fusarium hainanense","AAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymellaceae;Epicoccum;Epicoccum tritici","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Erysiphales;Erysiphaceae;Erysiphe;Erysiphe sp.","GAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCTCAAGCTGCCCTTGTGGTGGCTTCGGTGTTGGGGCTCGTCGCAGTTTTGCGGTGGCCCTTAAAGACAGTGGCGGTCCCCGCGTGGGCTCTACGCGTAGTAACTTGTTCCTCGCGACAGAGTGACGCTCGTGATCAGCCAGAACCACCCACCTTTGTCCGGTCATCCGGATTGACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymosphaeriaceae;Paraconiothyrium;Paracamarosporium tamaricis","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCGCCTCTGCGCGCGGACTCGCCCCAAATTCATTGGCAGCGGTCCTTGCCTCCTCTCGCGCAGCACATTGCGCTTCTCGAGGTGCGCGGCCCGCGTCCACGAAGCAACATTACCGTCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Debaryomycetaceae;Meyerozyma;Meyerozyma caribbica","GAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTGGATAGTGCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGATATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Exobasidiomycetes;Microstromatales;Quambalariaceae;Quambalaria;Quambalaria simpsonii","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCTAGGAGCATGCCTGTTTGAGTGTCATGAATTCCTCAAACCCCAATGTTTTGCAAAATTCATTGCTTGGGTTTGGTTGTGGGCCTATATTGCTGCTTCACGGCAGCTGGCCTTAAAGATATTAGCTGGACTCTCCGAGACTCTTGGATAGTTCCACTTGATGTGATAAATTTGCATCGGTGGGTCAAGACTATGCTTGGGAAGTGTGAGAAGTCTGCTTCTAATCCGGCAAGAGGTTCCATCCTCGACCCAATTCATTTACAACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Saccharomycodaceae;Hanseniaspora;Hanseniaspora pseudoguilliermondii","GAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGCCCTTGAGCATTCTCAAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGATAATTTTTTATTTTTTGGTTGTGGGCGATACTCAGGGTTAGCTTGAAATTGGAGACTGTTTCAGTCTTTTTTAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTTATTCGTTTTACTTTACAAGGGAAATGGTAACGTACCTTAGGCAAAGGGTTGCTTTTAATATTCATCAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Metschnikowia;Metschnikowia_Group_pulcherrima_chrysoperlae","GAAATGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Sordariomycetes;Hypocreales;Hypocreales incertae sedis;Acremonium;Acremonium sclerotigenum","AAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCAGGACCCGTTCGCGGGACCTGGCGTTGGGGATCAGCCTGCCCCTGGCGGCGGCTGGCCCTGAAATCCAGTGGCGGTTCCCTCGCGAACTCCTCCGTGCAGTAATTAAACCTCTCGCGGCAGGATAGCGGTTGAACCACGCCGTTAAACCCCCCACTTCTCAAGGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Cladosporiales;Cladosporiaceae;Cladosporium;Cladosporium sp.","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium_Group_nalgiovense_melanoconidium","GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymellaceae;Nothophoma;Nothophoma macrospora","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTCAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae;Alternaria;Alternaria_Group_conjuncta_murispora","GAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTGTCTCCAGTTCGCTGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTTCGCCAGCCAAGGTCAGCGTCCAGCAAGCCTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymellaceae;Epicoccum;Epicoccum tritici","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCACAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium bialowiezense","GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACTCGCTTTGTAGGCCTGGCCGGCGCTTGCCGATCAACCAAACTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Metschnikowiaceae;Kodamaea;Kodamaea ohmeri","GAAATGCGATACGTAATACGAATCGCAGCTCTCGGAATCATCGAATCTTTGAACGCACATTGCACCATTGGGTATTCCCAATGGTATGCTTGTTTGAGCGAATACTTCCCTAATCCTCACGGATTGTATTGTGTTTGCACGAAAATAATGACGACAGTACTCTACAAAACGGTACCGTCAGTACACTCATTTTTTTTCCTCAAATCAAGTAGGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Didymellaceae;Epicoccum;Epicoccum italicum","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTTGTCTCGCCTCCGCGCGCAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium_Group_hirsutum_italicum_resticulosum_tricolor_expansum_marinum_compactum","GAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_langeronii_neolangeronii","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGTGGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_acalyphae_angudtiterminale_angustiporum_asperulatum","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Filobasidiaceae;Filobasidium;Filobasidium oeirense","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAAACCCAAGTTTTGGATTTCGATCCATGCTTGAGTTTGGATTTGGATGTTTGCCGGTGATGAACCGACTCATCTTAAAAGTATTAGCTTGGATCTGTCTATATGACTGGTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTTTGCCGGTGATGAACCGACTCATCTTAAAAGTATTAGCTGGATCTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTGAGGACATCTTCGGATGGCCAGGACCTAGACTATTGTCTGCTAACTAAACCATCACTTTAAGTGCATCCTTGGATGTTACTCATTGTGTAACTTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae;Sclerostagonospora;Sclerostagonospora cycadis","GAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTACACCCTCAAGCTCAGCTTGGTGTTGGGCGTCTGTCCCGCTTCGTGCGTGGACTCGCCCCAAAGGTATTGGCAGCGGTCCTTGCCAGCTTCTCGCGCAGCACATTGCGCTTCTCGAGGCTGGCGGATCGGCGTCCATCAAGCCCACTTCCACAGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Sordariomycetes;Hypocreales;Nectriaceae;Fusarium;Fusarium foetens","AAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Tremellales;Bulleribasidiaceae;Vishniacozyma;Vishniacozyma victoriae","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATGAAACCTCACCCCACTTAGGTTTTTGCCTAAGCGGTGGTGTATTGGGTGTTTGCCTTGCTAAAGGCTCGCCTTAAAGATATAAGCACCTTGGATGTAATACGTTTCATCCTTCTGGGTGGCTGATAACCCCACATATTCATGATCTGGCCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_acalyphae_angudtiterminale_angustiporum_asperulatum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Trichosporonales;Trichosporonaceae;Trichosporon;Trichosporon_Group_insectorum_faecale_coremiiforme_asteroides_japonicum","GAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTGGATTTGGGCGTCTGCGATCTCTGATCGCTCGCCTTAAAAGAGTTAGCAAGTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGGTCCATTGTGTTGAAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGCCTGAAATCAGGTAGGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_allicinum_antarticum_variabile_tenellum","GAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_acalyphae_angudtiterminale_angustiporum_asperulatum","GAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Filobasidiaceae;Naganishia;Naganishia diffluens","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCTTAGATTGGTTAACACCTTTCTTTGGCTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAAGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATATTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium_Group_brevicompactum_kongi","GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACAACCAATCATCCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_acalyphae_angudtiterminale_angustiporum_asperulatum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Penicillium;Penicillium_Group_brevicompactum_kongi","GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_allicinum_antarticum_variabile_tenellum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Aspergillaceae;Aspergillus;Aspergillus_Group_costaricensis_luchuensis_tubingensis","GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Dothideomycetes;Capnodiales;Cladosporiaceae;Cladosporium;Cladosporium_Group_allicinum_antarticum_variabile_tenellum","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Basidiomycota;Tremellomycetes;Tremellales;Rhynchogastremataceae;Papiliotrema;Papiliotrema_sp2","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGGCTTGGACTTGGGTGTCTGCCAGCAATGGCTCACCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGGCTTGGACTTGGGTGTCTGCCAGTGATGGCTCACCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGCGATGACTGCTCAGAACCTGCCATCGCGCATCTTTTGACTTTGACCTGAAATCAGGTAGGGCTACCCGCTGAACTTAA_FROGS_combined")
t <- change_complete_taxo(t,"Fungi;Ascomycota;Leotiomycetes;Helotiales;Sclerotiniaceae;Botrytis;Botrytis_Group_californica_caroliniana","GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTTAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA_FROGS_combined")
to_remove <- c("AAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCTCGTCGCCCCCTGCCACACATCCTAAAGGTGTAATAATGGTCATGGGGGCGGAAATTGGCCTCCCGTTCTTGTGTTTGGTTGGCCTAAAGATGAGTCCCCTTAGGGCGGATGCACAACTAGTGGTGGTTGAATAGACCCTCGTCTTGTGTTGTGTGTCGTGAGCTGTGAGGGAAATTCTCAACTTAGACCCCACTGTATCGTTAAAAAACGATATATCGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAA",
"AAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCTCGTCGCCCCCTGCCACACATCCTAAAGGTGTAATAATGGTCATGGGGGCGGAAATTGGCCTCCCGTTCTTGTGTTTGGTTGGCCTAAAGATGAGTCCCCTTAGGGCGGATGCACAACTAGTGGTGGTTGAATAGACCCTCGTCTTGTGTTGTGTGTCGTGAGCTGTGAGGGAAATTCTCAATTTAGACCCCACTGTATCGTTAAAAAACGATATATCGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAA"
"AAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCTCGTCGCCCCCTGCCACACATCCTAAAGGTGTAATAATGGTCATGGGGGCGGAAATTGGCCTCCCGTTCTTGTGTTTGGTTGGCCTAAAGATGAGTCCCCTTAGGGCGGATGCACAACTAGTGGTGGTTGAATAGACCCTCGTCTTGTGTTGTGTGTCGTGAGCTGTGAGGGAAATTCTCAATTTAGACCCCACTGTATCGTTAAAAAACGATATATCGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAA",
"GAAGTGCGATAAGTAGTGTGAATTGCAGATTTCCGTGAACCATCGAGTTTTTGAACGCAAATTGCGCTCGAGGCCTCCGGGTCGAGAGCATGTCTGCCTCAGCGTCGCTCATACCCAATCGGCTCCACCTCTTTTGAAATATAAAGCTAGGCGGGCCGGATGTGGCCGTCCGGTTTTATTAGCCGGTTGGCTGAAAGATTCGTTCCGCTCGCAGCCTCCCTTAAATGGGAAGGAGCCAGCCGGTAAGCATGACCTTGTCTAACTGGAGAAGGTCTGGCCTGCCGTTGAGCTCTGGTTGTGGGTTTCATAGGAACTTGACAGGAACTGACATTTGAAAATCGACCTGAGATCAGGCAAGGACACCCGCTGAACTTAA"
)
tax_table(phyloseq) <- t
......
......@@ -114,41 +114,246 @@ raw_data <- read.csv2("data/metadata_real_reads.tsv" , sep = "\t", stringsAsFact
```
# MEAT
## Analysis of raw BIOM files {.tabset}
```{r, eval=T}
if (!file.exists("REAL_MEAT/ITS1.rds")) {
biomfile <- "REAL_MEAT/ITS1.biom"
physeq_its1 <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq_its1) <- gsub(tax_table(physeq_its1), pattern = "[a-z]__", replacement = "")
metadata <- read.table("REAL_MEAT/metadata.tsv", row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq_its1) <- metadata
sample_data(physeq_its1)$Marker <- "ITS1"
sample_data(physeq_its1)$Type <- "Raw"
sample_data(physeq_its1)$Reads <- raw_data %>% filter(Ecosystem == "MEAT") %>% filter(Marker == "ITS1") %>% pull(Reads)
sample_names(physeq_its1) <- glue::glue(paste("{sample_names(physeq_its1)}","ITS1", sep="_"))
saveRDS(physeq_its1,"REAL_MEAT/ITS1.rds")
} else {
physeq_its1 <- readRDS("REAL_MEAT/ITS1.rds")
dir <- paste("REAL",eco, sep="_")
ecos <- c("MEAT")
markers <- c("ITS1","ITS2","D1D2","RPB2")
for(eco in ecos){
for(marker in markers){
#if (!file.exists(file.path(dir,paste0(marker,".rds")))) {
biomfile <- file.path(dir,paste0(marker,".biom"))
physeq <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq) <- gsub(tax_table(physeq),pattern = "[a-z]__", replacement = "")
metadata <- read.table(file.path(dir,"metadata.tsv"), row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq) <- metadata
sample_data(physeq)$Marker <- marker
sample_data(physeq)$Type <- "Raw"
#sample_data(physeq)$Reads <- raw_data %>% filter(Ecosystem == eco) %>% filter(Marker == marker) %>% pull(Reads)
sample_names(physeq) <- glue::glue(paste("{sample_names(physeq)}",marker,"RAW",sep="_"))
saveRDS(physeq,file.path(dir,paste0(marker,".rds")))
#}
#if (!file.exists(file.path(dir,paste0(marker,"_final.rds")))) {
if(eco == "MEAT"){
if(marker == "ITS1"){
physeq_final <- curation_meat_its1(physeq)
}else if(marker == "ITS2"){
physeq_final <- curation_meat_its2(physeq)
}else if (marker == "D1D2"){
physeq_final <- curation_meat_d1d2(physeq)
}else{
physeq_final <- curation_meat_rpb2(physeq)
}
}else if(eco == "CHEESE"){
if(marker == "ITS1") physeq_final <- curation_cheese_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_cheese_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_cheese_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_cheese_rpb2(physeq)
}else if(eco == "BREAD"){
if(marker == "ITS1") physeq_final <- curation_bread_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_bread_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_bread_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_bread_rpb2(physeq)
}else if(eco == "WINE"){
if(marker == "ITS1") physeq_final <- curation_wine_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_wine_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_wine_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_wine_rpb2(physeq)
}
sample_data(physeq_final)$Type <- "Curated"
#sample_data(physeq_final)$Reads <- sample_sums(physeq_final)
sample_names(physeq_final) <- glue::glue(paste("{sample_data(physeq)$SampleID}",marker,"CURATED", sep="_"))
saveRDS(physeq_final,file.path(dir,paste0(marker,"_final.rds")))
#}
}
}
```
# Sequencing depth {.tabset}
## MEAT {.tabset}
### ITS1
```{r, eval=T}
physeq <- readRDS("REAL_MEAT/ITS1.rds")
physeq_final <- readRDS("REAL_MEAT/ITS1_final.rds")
physeq_all <- merge_phyloseq(physeq, physeq_final)
p <- plot_composition(physeq_all, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_bar(physeq_all, x="Type") + facet_grid(~SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
```
### ITS2
```{r, eval=T}
physeq <- readRDS("REAL_MEAT/ITS2.rds")
physeq_final <- readRDS("REAL_MEAT/ITS2_final.rds")
physeq_all <- merge_phyloseq(physeq, physeq_final)
p <- plot_composition(physeq_all, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_bar(physeq_all, x="Type") + facet_grid(~SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
```
### D1D2
```{r, eval=T}
physeq <- readRDS("REAL_MEAT/D1D2.rds")
physeq_final <- readRDS("REAL_MEAT/D1D2_final.rds")
physeq_all <- merge_phyloseq(physeq, physeq_final)
p <- plot_composition(physeq, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_composition(physeq_final, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_composition(physeq_all, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_bar(physeq_all, x="Type") + facet_grid(~SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
```
### RPB2
```{r, eval=T}
physeq <- readRDS("REAL_MEAT/RPB2.rds")
physeq_final <- readRDS("REAL_MEAT/RPB2_final.rds")
physeq_all <- merge_phyloseq(physeq, physeq_final)
p <- plot_composition(physeq_all, "Kingdom", "Fungi", "Family", x = "Type") +
scale_y_continuous(expand = expansion(0, 0)) +
scale_x_discrete(expand = expansion(0, 0)) +
facet_grid(~ SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
p <- plot_bar(physeq_all, x="Type") + facet_grid(~SampleID)
p$data$Type <- factor(p$data$Type, levels = c("Raw","Curated"))
p
```
```{r}
#if (!file.exists(file.path(dir,paste0(marker,".rds")))) {
biomfile <- file.path(dir,paste0(marker,".biom"))
physeq <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq) <- gsub(tax_table(physeq), pattern = "[a-z]__", replacement = "")
metadata <- read.table(file.path(dir,"metadata.tsv"), row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq) <- metadata
sample_data(physeq)$Marker <- marker
sample_data(physeq)$Type <- "Raw"
sample_data(physeq)$Reads <- raw_data %>% filter(Ecosystem == eco) %>% filter(Marker == marker) %>% pull(Reads)
sample_names(physeq) <- glue::glue(paste("{sample_names(physeq)}",marker,"RAW",sep="_"))
saveRDS(physeq,file.path(dir,paste0(marker,".rds")))
if(eco == "MEAT"){
if(marker == "ITS1") physeq_final <- curation_meat_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_meat_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_meat_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_meat_rpb2(physeq)
}else if(eco == "CHEESE"){
if(marker == "ITS1") physeq_final <- curation_cheese_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_cheese_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_cheese_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_cheese_rpb2(physeq)
}else if(eco == "BREAD"){
if(marker == "ITS1") physeq_final <- curation_bread_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_bread_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_bread_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_bread_rpb2(physeq)
}else if(eco == "WINE"){
if(marker == "ITS1") physeq_final <- curation_wine_its1(physeq)
if(marker == "ITS2") physeq_final <- curation_wine_its2(physeq)
if(marker == "D1D2") physeq_final <- curation_wine_d1d2(physeq)
if(marker == "RPB2") physeq_final <- curation_wine_rpb2(physeq)
}
if(marker == "ITS1"){
physeq_final <- curation_meat_its1(physeq)
}
sample_data(physeq_final)$Type <- "Curated"
sample_data(physeq_final)$Reads <- sample_sums(physeq_final)
sample_names(physeq_final) <- glue::glue(paste("{sample_data(physeq)$Sample}",marker,"CURATED", sep="_"))
saveRDS(physeq_final,file.path(dir,paste0(marker,"_final.rds")))
#} else {
# physeq_its1 <- readRDS("REAL_MEAT/ITS1.rds")
#}
#if (!file.exists("REAL_MEAT/ITS1_final.rds")) {
physeq_its1_final <- curation_meat_its1(physeq_its1)
sample_data(physeq_its1_final)$Type <- "Curated"
sample_data(physeq_its1_final)$Reads <- sample_sums(physeq_its1_final)
sample_names(physeq_its1_final) <- glue::glue(paste("{sample_data(physeq_its1)$Sample}","ITS1","CURATED", sep="_"))
saveRDS(physeq_its1_final,"REAL_MEAT/ITS1_final.rds")
#} else {
# physeq_its1_final <- readRDS("REAL_MEAT/ITS1_final.rds")
#}
if (!file.exists("REAL_MEAT/ITS2.rds")) {
#if (!file.exists("REAL_MEAT/ITS2.rds")) {
biomfile <- "REAL_MEAT/ITS2.biom"
physeq_its2 <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq_its2) <- gsub(tax_table(physeq_its2), pattern = "[a-z]__", replacement = "")
metadata <- read.table("REAL_MEAT/metadata.tsv", row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq_its2) <- metadata
sample_data(physeq_its2)$Marker <- "ITS2"
sample_data(physeq_its2)$Type <- "Raw"
sample_data(physeq_its2)$Reads <- raw_data %>% filter(Ecosystem == "MEAT") %>% filter(Marker == "ITS2") %>% pull(Reads)
sample_names(physeq_its2) <- glue::glue(paste("{sample_names(physeq_its2)}","ITS2", sep="_"))
saveRDS(physeq_its2,"REAL_MEAT/ITS2.rds")
} else {
physeq_its2 <- readRDS("REAL_MEAT/ITS2.rds")
}
if (!file.exists("REAL_MEAT/D1D2.rds")) {
#} else {
#physeq_its2 <- readRDS("REAL_MEAT/ITS2.rds")
#}
#if (!file.exists("REAL_MEAT/ITS2_final.rds")) {
physeq_its2_final <- curation_meat_its2(physeq_its2)
sample_data(physeq_its2_final)$Type <- "Curated"
sample_data(physeq_its2_final)$Reads <- sample_sums(physeq_its2_final)
sample_names(physeq_its2_final) <- glue::glue(paste("{sample_data(physeq_its2)$Sample}","ITS2","CURATED", sep="_"))
saveRDS(physeq_its2_final,"REAL_MEAT/ITS2_final.rds")
#} else {
# physeq_its2_final <- readRDS("REAL_MEAT/ITS2_final.rds")
#}
#if (!file.exists("REAL_MEAT/D1D2.rds")) {
biomfile <- "REAL_MEAT/D1D2.biom"
physeq_d1d2 <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq_d1d2) <- gsub(tax_table(physeq_d1d2), pattern = "[a-z]__", replacement = "")
......@@ -156,36 +361,38 @@ if (!file.exists("REAL_MEAT/D1D2.rds")) {
metadata <- read.table("REAL_MEAT/metadata.tsv", row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq_d1d2) <- metadata
sample_data(physeq_d1d2)$Marker <- "D1D2"
sample_data(physeq_d1d2)$Type <- "Raw"
sample_data(physeq_d1d2)$Reads <- raw_data %>% filter(Ecosystem == "MEAT") %>% filter(Marker == "D1D2") %>% pull(Reads)
sample_names(physeq_d1d2) <- glue::glue(paste("{sample_names(physeq_d1d2)}","D1D2", sep="_"))
saveRDS(physeq_d1d2,"REAL_MEAT/D1D2.rds")
} else {
physeq_d1d2 <- readRDS("REAL_MEAT/D1D2.rds")
}
#} else {
# physeq_d1d2 <- readRDS("REAL_MEAT/D1D2.rds")
#}
if (!file.exists("REAL_MEAT/RPB2.rds")) {
#if (!file.exists("REAL_MEAT/RPB2.rds")) {
biomfile <- "REAL_MEAT/RPB2.biom"
physeq_rpb2 <- import_frogs(biomfile, taxMethod = "blast")
tax_table(physeq_rpb2) <- gsub(tax_table(physeq_rpb2), pattern = "[a-z]__", replacement = "")
metadata <- read.table("REAL_MEAT/metadata.tsv", row.names = 1, header = TRUE, sep = "\t", stringsAsFactors = FALSE)
sample_data(physeq_rpb2) <- metadata
sample_data(physeq_rpb2)$Marker <- "RPB2"
sample_data(physeq_rpb2)$Type <- "Raw"
sample_data(physeq_rpb2)$Reads <- raw_data %>% filter(Ecosystem == "MEAT") %>% filter(Marker == "RPB2") %>% pull(Reads)
sample_names(physeq_rpb2) <- glue::glue(paste("{sample_names(physeq_rpb2)}","RPB2", sep="_"))
saveRDS(physeq_rpb2,"REAL_MEAT/RPB2.rds")
} else {
physeq_rpb2 <- readRDS("REAL_MEAT/RPB2.rds")
}
#} else {
# physeq_rpb2 <- readRDS("REAL_MEAT/RPB2.rds")
#}
```
```{r, eval=T}
if (!file.exists("REAL_MEAT/meat.rds")){
#if (!file.exists("REAL_MEAT/meat.rds")){
meat_all <- merge_phyloseq(physeq_its1, physeq_its2, physeq_d1d2, physeq_rpb2)
sample_data(meat_all)$Marker <- factor(sample_data(meat_all)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(meat_all,"REAL_MEAT/meat.rds")
}else{
meat_all <- readRDS("REAL_MEAT/meat.rds")
}
#}else{
# meat_all <- readRDS("REAL_MEAT/meat.rds")
#}
```
......@@ -264,8 +471,14 @@ ggVennDiagram(x,label_alpha = 0) +
physeq_its1_final <- curation_meat_its1(physeq_its1)
sample_data(physeq_its1_final)$Type <- "Curated"
sample_data(physeq_its1_final)$Reads <- sample_sums(physeq_its1_final)
sample_names(physeq_its1_final) <- glue::glue(paste("{sample_names(physeq_its1)}","CURATED", sep="_"))
sample_names(physeq_its1_final) <- glue::glue(paste("{sample_data(physeq_its1)$Sample}","ITS1","CURATED", sep="_"))
toto <- merge_phyloseq(physeq_its1, physeq_its1_final)
p <- plot_composition(physeq = toto, taxaRank1 = "Kingdom", taxaSet1 = "Fungi", taxaRank2 = "Species", numberOfTaxa = 22, x = "Sample")
p <- p + facet_grid(". ~ Sample", scales = "free_x", space = "free")
p + theme(legend.position="bottom")
p
saveRDS(physeq_its1_final,"REAL_MEAT/ITS1_final.rds")
......@@ -1189,8 +1402,8 @@ ggVennDiagram(x,label_alpha = 0) +
physeq_its1_final <- curation_wine_its1(physeq_its1)
saveRDS(physeq_its1_final,"REAL_WINE/ITS1_final.rds")
#physeq_its2_final <- curation_wine_its2(physeq_its2)
#saveRDS(physeq_its2_final,"REAL_WINE/ITS2_final.rds")
physeq_its2_final <- curation_wine_its2(physeq_its2)
saveRDS(physeq_its2_final,"REAL_WINE/ITS2_final.rds")
physeq_d1d2_final <- curation_wine_d1d2(physeq_d1d2)
saveRDS(physeq_d1d2_final,"REAL_WINE/D1D2_final.rds")
......@@ -1203,7 +1416,7 @@ saveRDS(physeq_rpb2_final,"REAL_WINE/RPB2_final.rds")
```{r, eval=T}
#if (!file.exists("REAL_WINE/wine_final.rds")){
wine_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2, physeq_d1d2_final, physeq_rpb2_final)
wine_all_final <- merge_phyloseq(physeq_its1_final, physeq_its2_final, physeq_d1d2_final, physeq_rpb2_final)
sample_data(wine_all_final)$Marker <- factor(sample_data(wine_all_final)$Marker, levels=c("ITS1","ITS2","D1D2","RPB2"))
saveRDS(wine_all_final,"REAL_WINE/wine_final.rds")
#}else{
......
......@@ -11,17 +11,25 @@
<meta name="author" content="Olivier Rué" />
<meta name="date" content="2022-01-12" />
<meta name="date" content="2022-01-18" />
<title>Real samples analysis</title>
<script src="real_samples_files/header-attrs-2.6/header-attrs.js"></script>
<script src="real_samples_files/jquery-1.11.3/jquery.min.js"></script>
<meta name="viewport" content="width=device-width, initial-scale=1" />
<link href="real_samples_files/bootstrap-3.3.5/css/bootstrap.min.css" rel="stylesheet" />
<script src="real_samples_files/bootstrap-3.3.5/js/bootstrap.min.js"></script>
<script src="real_samples_files/bootstrap-3.3.5/shim/html5shiv.min.js"></script>
<script src="real_samples_files/bootstrap-3.3.5/shim/respond.min.js"></script>
<style>h1 {font-size: 34px;}
h1.title {font-size: 38px;}
h2 {font-size: 30px;}
h3 {font-size: 24px;}
h4 {font-size: 18px;}
h5 {font-size: 16px;}
h6 {font-size: 12px;}
code {color: inherit; background-color: rgba(0, 0, 0, 0.04);}
pre:not([class]) { background-color: white }</style>
<script src="real_samples_files/jqueryui-1.11.4/jquery-ui.min.js"></script>
<link href="real_samples_files/tocify-1.9.1/jquery.tocify.css" rel="stylesheet" />
<script src="real_samples_files/tocify-1.9.1/jquery.tocify.js"></script>
......@@ -40,11 +48,6 @@
</style>
<style type="text/css">code{white-space: pre;}</style>
<style type="text/css">
pre:not([class]) {
background-color: white;
}
</style>
<script type="text/javascript">
if (window.hljs) {
hljs.configure({languages: []});
......@@ -57,32 +60,6 @@ if (window.hljs) {
<style type="text/css">
h1 {
font-size: 34px;
}
h1.title {
font-size: 38px;
}
h2 {
font-size: 30px;
}
h3 {
font-size: 24px;
}
h4 {
font-size: 18px;
}
h5 {
font-size: 16px;
}
h6 {
font-size: 12px;
}
.table th:not([align]) {
text-align: left;
}
</style>
......@@ -94,10 +71,6 @@ h6 {
margin-left: auto;
margin-right: auto;
}
code {
color: inherit;
background-color: rgba(0, 0, 0, 0.04);
}
img {
max-width:100%;
}
......@@ -113,6 +86,9 @@ button.code-folding-btn:focus {
summary {
display: list-item;
}
pre code {
padding: 0;
}
</style>
......@@ -125,7 +101,6 @@ summary {
max-height: 500px;
min-height: 44px;
overflow-y: auto;
background: white;
border: 1px solid #ddd;
border-radius: 4px;
}
......@@ -254,7 +229,7 @@ div.tocify {
<!-- setup 3col/9col grid for toc_float and main content -->
<div class="row-fluid">
<div class="row">
<div class="col-xs-12 col-sm-4 col-md-3">
<div id="TOC" class="tocify">
</div>
......@@ -265,11 +240,11 @@ div.tocify {
<div class="fluid-row" id="header">
<div id="header">
<div class="btn-group pull-right">
<button type="button" class="btn btn-default btn-xs dropdown-toggle" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"><span>Code</span> <span class="caret"></span></button>
<ul class="dropdown-menu" style="min-width: 50px;">
<div class="btn-group pull-right float-right">
<button type="button" class="btn btn-default btn-xs btn-secondary btn-sm dropdown-toggle" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"><span>Code</span> <span class="caret"></span></button>
<ul class="dropdown-menu dropdown-menu-right" style="min-width: 50px;">
<li><a id="rmd-show-all-code" href="#">Show All Code</a></li>
<li><a id="rmd-hide-all-code" href="#">Hide All Code</a></li>
</ul>
......@@ -279,7 +254,7 @@ div.tocify {
<h1 class="title toc-ignore">Real samples analysis</h1>
<h4 class="author">Olivier Rué</h4>
<h4 class="date">2022-01-12</h4>
<h4 class="date">2022-01-18</h4>
</div>
......@@ -335,7 +310,7 @@ grep -f to_keep.lst affiliation.tsv &gt;&gt; affiliation-filtered-final.tsv</cod
<div id="meat" class="section level1">
<h1>MEAT</h1>
<div id="analysis-of-raw-biom-files" class="section level2 tabset">
<h2 class="tabset">Analysis of raw BIOM files</h2>
<h2>Analysis of raw BIOM files</h2>
<pre class="r"><code>if (!file.exists(&quot;REAL_MEAT/ITS1.rds&quot;)) {
biomfile &lt;- &quot;REAL_MEAT/ITS1.biom&quot;
physeq_its1 &lt;- import_frogs(biomfile, taxMethod = &quot;blast&quot;)
......@@ -343,6 +318,7 @@ grep -f to_keep.lst affiliation.tsv &gt;&gt; affiliation-filtered-final.tsv</cod
metadata &lt;- read.table(&quot;REAL_MEAT/metadata.tsv&quot;, row.names = 1, header = TRUE, sep = &quot;\t&quot;, stringsAsFactors = FALSE)
sample_data(physeq_its1) &lt;- metadata
sample_data(physeq_its1)$Marker &lt;- &quot;ITS1&quot;
sample_data(physeq_its1)$Type &lt;- &quot;Raw&quot;