...
 
Commits (6)
......@@ -78,20 +78,23 @@ to_write = []
#remplissage
#contig_renames [ald_name]=newname
#reecriture du fasta
contigs_len=0
with open(args.fnaFile, "rU") as fnaFile,\
open(args.outFNAFile, "w") as outFNA_handle:
for record in SeqIO.parse(fnaFile, "fasta"):
try :
old_ctg_name = record.id
new_ctg_name = ctg_prefix + old_ctg_name.split("_")[-1]
contig_renames[old_ctg_name] = new_ctg_name
record.id = contig_renames[old_ctg_name]
record.description = record.description.replace(old_ctg_name,"")
SeqIO.write(record, outFNA_handle, "fasta")
contigs_len += len(record)
except :
print ("Warning FNA file : contig " + record.id + " discarded, no new name defined")
pass
print (args.fnaFile, " nb contigs: ", len(contig_renames), " nb bases: ",contigs_len)
with open(args.file) as gffFile,\
open(args.outGFFFile, "w") as out_handle,\
......@@ -130,7 +133,6 @@ with open(args.file) as gffFile,\
to_write.append(rec)
#Write only one time
#print (to_write)
GFF.write(to_write, out_handle)
......@@ -143,7 +145,7 @@ with open(args.fastaFile, "rU") as handle,\
record.description = record.description.replace(old + " ","")
SeqIO.write(record, outFasta_handle, "fasta")
except :
print ("Warning FAA file : protein " + record.id + " discarded, no new name defined")
print ("Warning FAA file : gene " + record.id + " discarded, no new name defined")
pass
......@@ -156,5 +158,5 @@ with open(args.ffnFile, "rU") as handle,\
record.description = record.description.replace(old + " ","")
SeqIO.write(record, outFFN_handle, "fasta")
except :
print ("Warning FFN file : protein " + record.id + " discarded, no new name defined")
print ("Warning FFN file : gene " + record.id + " discarded, no new name defined")
pass
......@@ -31,45 +31,45 @@ process {
memory = { 8.GB * task.attempt }
}
withName: host_filter {
memory = { 200.GB * task.attempt }
memory = { 128.GB * task.attempt }
time = '48h'
cpus = 8
}
withName: index_db_kaiju {
memory = { 200.GB * task.attempt }
cpus = 6
memory = { 128.GB * task.attempt }
cpus = 8
}
withName: kaiju {
memory = { 50.GB * task.attempt }
cpus = 25
memory = { 64.GB * task.attempt }
cpus = 16
}
withName: metaspades {
memory = { 100.GB * task.attempt }
cpus = 40
memory = { 64.GB * task.attempt }
cpus = 16
}
withName: megahit {
cpus = 40
memory = { 100.GB * task.attempt }
cpus = 16
memory = { 64.GB * task.attempt }
}
withName: assembly_metrics {
memory = { 100.GB * task.attempt }
withName: quast {
cpus = 2
}
withName: prokka {
memory = { 45.GB * task.attempt }
memory = { 8.GB * task.attempt }
cpus = 8
}
withName: rename_contigs_genes{
memory = { 20.GB * task.attempt }
memory = { 24.GB * task.attempt }
}
withLabel: cd_hit {
memory = { 50.GB * task.attempt }
memory = { 64.GB * task.attempt }
cpus = 16
}
withName: quantification {
memory = { 50.GB * task.attempt }
memory = { 24.GB * task.attempt }
}
withName: diamond {
cpus = 8
memory = { 4.GB * task.attempt }
memory = { 8.GB * task.attempt }
}
}
......@@ -2,7 +2,7 @@ process.executor = 'slurm'
singularity.enabled = true
singularity.autoMounts = true
singularity.runOptions = "-B /work/bank/ -B /bank -B /work2 -B /work -B /save -B /home -B /work/project"
process.queue = 'testq'
process.queue = 'workq'
/*
process {
withName: host_filter {
......
......@@ -3,17 +3,23 @@ From: continuumio/miniconda3
IncludeCmd: yes
%files
metagWGS_dependancies.yml /
env_metagWGS_1.3_v2.yml /
%post
apt-get update && apt-get install -y procps && apt-get clean -y
/opt/conda/bin/conda env create -n metagWGS_dependancies -f /metagWGS_dependancies.yml
apt-get install -y libidn11
/opt/conda/bin/conda env create -n metagWGS_1.3 -f /env_metagWGS_1.3_v2.yml
/opt/conda/bin/conda clean -a
wget ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/converters/by_program/tbl2asn/linux64.tbl2asn.gz -O linux64.tbl2asn.gz
gunzip linux64.tbl2asn.gz && mv linux64.tbl2asn /opt/conda/envs/metagWGS_dependancies/bin/tbl2asn && chmod 755 /opt/conda/envs/metagWGS_dependancies/bin/tbl2asn
%environment
export PATH=/opt/conda/bin:$PATH
. /opt/conda/etc/profile.d/conda.sh
conda activate metagWGS_dependancies
conda activate metagWGS_1.3
%runscript
"$@"
name: metagWGS_dependancies
name: env_metagWGS_1.3_v2
channels:
- bioconda
- defaults
- conda-forge
- defaults
dependencies:
- _libgcc_mutex=0.1
- _openmp_mutex=4.5
- alsa-lib=1.1.5
- aragorn=1.2.38
- barrnap=0.9
- bcbio-gff=0.6.6
- bedtools=2.29.0
- biopython=1.74
- bedtools=2.29.2
- biopython=1.76
- blast=2.9.0
- boost-cpp=1.70.0
- bwa=0.7.17
- bx-python=0.8.6
- bx-python=0.8.8
- bzip2=1.0.8
- ca-certificates=2019.11.28
- cairo=1.16.0
......@@ -21,63 +23,69 @@ dependencies:
- certifi=2019.11.28
- cffi=1.13.2
- chardet=3.0.4
- circos=0.69.8
- click=7.0
- clustalw=2.1
- coloredlogs=10.0
- coloredlogs=14.0
- colormath=3.0.0
- cryptography=2.8
- curl=7.65.3
- cutadapt=2.7
- curl=7.68.0
- cutadapt=2.8
- cycler=0.10.0
- dbus=1.13.6
- decorator=4.4.1
- diamond=0.9.29
- decorator=4.4.2
- diamond=0.9.30
- dnaio=0.4.1
- entrez-direct=11.0
- expat=2.2.5
- fastqc=0.11.8
- entrez-direct=13.3
- expat=2.2.9
- fastqc=0.11.9
- font-ttf-dejavu-sans-mono=2.37
- fontconfig=2.13.1
- fraggenescan=1.31
- freetype=2.10.0
- fribidi=1.0.5
- future=0.18.2
- gettext=0.19.8.1
- giflib=5.1.9
- giflib=5.2.1
- glib=2.58.3
- glimmerhmm=3.0.4
- graphite2=1.3.13
- graphviz=2.42.3
- gst-plugins-base=1.14.5
- gstreamer=1.14.5
- harfbuzz=2.4.0
- hmmer=3.2.1
- htslib=1.10
- humanfriendly=4.18
- hmmer=3.3
- htslib=1.10.2
- humanfriendly=8.0
- icu=64.2
- idna=2.8
- idna=2.9
- infernal=1.1.2
- jinja2=2.10.3
- jinja2=2.11.1
- joblib=0.14.1
- jpeg=9c
- kaiju=1.7.2
- kaiju=1.7.3
- kiwisolver=1.1.0
- krb5=1.16.3
- krb5=1.16.4
- krona=2.7.1
- ld_impl_linux-64=2.33.1
- lcms2=2.9
- libblas=3.8.0
- libcblas=3.8.0
- libclang=9.0.0
- libcurl=7.65.3
- libclang=9.0.1
- libcurl=7.68.0
- libdb=6.1.26
- libdeflate=1.3
- libedit=3.1.20170329
- libfaketime=0.9.8
- libffi=3.2.1
- libgcc-ng=9.2.0
- libgd=2.2.5
- libgfortran-ng=7.3.0
- libgomp=9.2.0
- libiconv=1.15
- libidn11=1.34
- libidn2=2.3.0
- liblapack=3.8.0
- libllvm9=9.0.0
- libllvm9=9.0.1
- libopenblas=0.3.7
- libpng=1.6.37
- libssh2=1.8.2
......@@ -88,14 +96,14 @@ dependencies:
- libuuid=2.32.1
- libwebp=1.0.2
- libxcb=1.13
- libxkbcommon=0.9.1
- libxkbcommon=0.10.0
- libxml2=2.9.10
- libxslt=1.1.33
- llvm-openmp=8.0.1
- lz4-c=1.8.3
- lzo=2.10
- lzstring=1.0.4
- markdown=3.1.1
- markdown=3.2.1
- markupsafe=1.1.1
- matplotlib=3.1.1
- matplotlib-base=3.1.1
......@@ -104,17 +112,17 @@ dependencies:
- multiqc=1.8
- ncurses=6.1
- networkx=2.2
- nspr=4.24
- nspr=4.25
- nss=3.47
- numpy=1.17.3
- numpy=1.18.1
- openjdk=11.0.1
- openmp=8.0.1
- openssl=1.1.1d
- paml=4.9
- pandas=0.25.3
- pandas=1.0.1
- pango=1.42.4
- parallel=20191122
- pcre=8.43
- parallel=20200122
- pcre=8.44
- perl=5.26.2
- perl-aceperl=1.92
- perl-algorithm-diff=1.1903
......@@ -152,6 +160,7 @@ dependencies:
- perl-common-sense=3.74
- perl-compress-raw-bzip2=2.087
- perl-compress-raw-zlib=2.087
- perl-config-general=2.63
- perl-constant=1.33
- perl-convert-binary-c=0.78
- perl-convert-binhex=1.125
......@@ -231,10 +240,13 @@ dependencies:
- perl-lwp-protocol-https=6.07
- perl-lwp-simple=6.15
- perl-mailtools=2.21
- perl-math-bezier=0.01
- perl-math-cdf=0.1
- perl-math-derivative=1.01
- perl-math-random=0.72
- perl-math-round=0.07
- perl-math-spline=0.02
- perl-math-vecstat=0.08
- perl-mime-base64=3.15
- perl-mime-lite=3.030
- perl-mime-tools=5.508
......@@ -250,11 +262,13 @@ dependencies:
- perl-net-http=6.19
- perl-net-ssleay=1.88
- perl-ntlm=1.09
- perl-number-format=1.75
- perl-ole-storage_lite=0.19
- perl-package-deprecationmanager=0.17
- perl-package-stash=0.38
- perl-package-stash-xs=0.28
- perl-params-util=1.07
- perl-params-validate=1.29
- perl-parent=0.236
- perl-parse-recdescent=1.967015
- perl-pathtools=3.75
......@@ -262,14 +276,18 @@ dependencies:
- perl-pod-escapes=1.07
- perl-pod-usage=1.69
- perl-postscript=0.06
- perl-readonly=2.05
- perl-regexp-common=2017060201
- perl-role-tiny=2.000008
- perl-scalar-list-utils=1.52
- perl-set-intspan=1.19
- perl-set-scalar=1.29
- perl-soap-lite=1.19
- perl-socket=2.027
- perl-sort-naturally=1.03
- perl-spreadsheet-parseexcel=0.65
- perl-spreadsheet-writeexcel=2.40
- perl-statistics-basic=1.6611
- perl-statistics-descriptive=3.0702
- perl-storable=3.15
- perl-sub-exporter=0.987
......@@ -293,6 +311,7 @@ dependencies:
- perl-test-requiresinternet=0.05
- perl-test-warn=0.36
- perl-text-diff=1.45
- perl-text-format=0.59
- perl-tie-ixhash=1.23
- perl-time-hires=1.9760
- perl-time-local=1.28
......@@ -324,42 +343,45 @@ dependencies:
- perl-xsloader=0.24
- perl-yaml=1.29
- pigz=2.3.4
- pip=19.3.1
- pip=20.0.2
- pixman=0.38.0
- prodigal=2.6.3
- prokka=1.14.5
- prokka=1.14.6
- pthread-stubs=0.4
- pycparser=2.19
- pyopenssl=19.1.0
- pyparsing=2.4.5
- pyparsing=2.4.6
- pyqt=5.12.3
- pysocks=1.7.1
- python=3.7.3
- python=3.6.7
- python-dateutil=2.8.1
- python-lzo=1.12
- pytz=2019.3
- pyyaml=5.2
- pyyaml=5.3
- qt=5.12.5
- quast=5.0.2
- readline=8.0
- requests=2.22.0
- requests=2.23.0
- samtools=1.10
- setuptools=42.0.2
- setuptools=45.2.0
- sickle-trim=1.33
- simplejson=3.17.0
- six=1.13.0
- spades=3.13.2
- six=1.14.0
- spades=3.14.0
- spectra=0.0.11
- sqlite=3.30.1
- subread=1.6.4
- subread=2.0.0
- t_coffee=11.0.8
- tbl2asn=25.7
- tbl2asn-forever=25.7.1f
- tidyp=1.04
- tk=8.6.10
- tornado=6.0.3
- urllib3=1.25.7
- wget=1.20.1
- wheel=0.33.6
- wheel=0.34.2
- xopen=0.8.4
- xorg-fixesproto=5.0
- xorg-inputproto=2.3.2
- xorg-kbproto=1.0.7
- xorg-libice=1.0.10
- xorg-libsm=1.2.3
......@@ -367,9 +389,13 @@ dependencies:
- xorg-libxau=1.0.9
- xorg-libxdmcp=1.1.3
- xorg-libxext=1.3.4
- xorg-libxpm=3.5.12
- xorg-libxfixes=5.0.3
- xorg-libxi=1.7.10
- xorg-libxpm=3.5.13
- xorg-libxrender=0.9.10
- xorg-libxt=1.1.5
- xorg-libxtst=1.2.3
- xorg-recordproto=1.14.2
- xorg-renderproto=0.11.1
- xorg-xextproto=7.3.0
- xorg-xproto=7.0.31
......@@ -380,4 +406,3 @@ dependencies:
- pip:
- pyqt5-sip==4.19.18
- pyqtwebengine==5.12.1
This diff is collapsed.
......@@ -8,8 +8,8 @@
params {
outdir = "results"
reads = "*_{R1,R2}.100000.fastq.gz"
adapter1 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
adapter2 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT"
adapter1 = "AGATCGGAAGAGC"
adapter2 = "AGATCGGAAGAGC"
qualityType = 'sanger'
mode = 'pe'
skip_sickle = false
......