Commit 3a241f9d authored by Joanna Fourquet's avatar Joanna Fourquet
Browse files

Update use_case.md

parent b921a480
......@@ -366,15 +366,15 @@ more ERR3201914_dedup_R2.nb_bases
#### 8. `03_filtering`
For each sample you will obtain two files and one directory:
- `SAMPLE_NAME_discard_contigs.10.fasta`
- `SAMPLE_NAME_select_contigs.10.fasta`
- `SAMPLE_NAME_select_contigs_QC`
- `SAMPLE_NAME_discard_contigs_cpm10.fasta`
- `SAMPLE_NAME_select_contigs_cpm10.fasta`
- `SAMPLE_NAME_select_contigs_QC/`
Now we are going to describe the results for the sample `ERR3201914`.
- `ERR3201914_discard_contigs.10.fasta` contains discarded contigs after filtering (contigs with CPM value < CPM_cutoff which is 10 here because we use default cutoff value). First lines of this file are:
- `ERR3201914_discard_contigs_cpm10.fasta` contains discarded contigs after filtering (contigs with CPM value < CPM_cutoff which is 10 here because we use default cutoff value). First lines of this file are:
```bash
head ERR3201914_discard_contigs.10.fasta
head ERR3201914_discard_contigs_cpm10.fasta
>NODE_1970_length_3822_cov_2.534908
CTGTGATCCACAGTTTCCTCCTGTTCCTGTCAACATTGGAATAAACGTATTTAAAATCGG
CATCACTGCAAGCGCTGCCTCAAAATGTCCTAAAATCAAACCTGTGATCGTTGCCGAGAG
......@@ -387,9 +387,9 @@ ACCTGTTGTCAGAAGATCTTTGACATCCACACTTCCAATCAGTTTTCTCTTTTCTGTCAC
ATAACAAGTATAGATCGTCTCTTTATTGATTCCGACCTGCCTGATTTTCAAAATTGCTTC
```
- `ERR3201914_select_contigs.10.fasta` contains contigs passing filter (contigs with CPM value >= CPM_cutoff which is 10 here because we use default cutoff value). First lines of this file are:
- `ERR3201914_select_contigs_cpm10.fasta` contains contigs passing filter (contigs with CPM value >= CPM_cutoff which is 10 here because we use default cutoff value). First lines of this file are:
```bash
head ERR3201914_select_contigs.10.fasta
head ERR3201914_select_contigs_cpm10.fasta
>NODE_1_length_451056_cov_35.997091
AATTGGTTTAGTAATTAAAAAAGGCGCTATATTATTGGCATGACAACAGGAATTAAAAAA
CCAAAACCATTAATGATTCCGTCACCCCATTCTGAGCTTTTAATATTTTAAAATCTGGAG
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment