json file listing; tests on all 7 steps of pipeline; added testing methods;...

json file listing; tests on all 7 steps of pipeline; added testing methods; refactoring main.nf from beggining to process kaiju_index; eggnog fix; diamond fix

functional_tests/functions.py

@@ -13,8 +13,8 @@ try:
     import sys
     import re
     import os
-    import os.path
-    from collections import defaultdict
+    import os.path as path
+    import json
     import subprocess
 
 except ImportError as error:
@@ -39,8 +39,10 @@ def parse_arguments():
     help = '(required) expected logs dir containing logs from a healthy metagwgs workflow')
     parser.add_argument('-obs_dir', type = str, \
     help = '(required) observed logs dir containing logs from the metagwgs workflow you wish to test')
+    parser.add_argument('-sampleIds', type = str, \
+    help = '(required) list of sample ids used as input for metagWGS (format: a,b,c,...')
     parser.add_argument('--script', type = str, \
-    help = '(optional) script file containing metagwgs Nextflow launch command ')
+    help = '(optional) script file containing metagwgs Nextflow launch command')
 
     if len(sys.argv) == 1:
         parser.print_usage(sys.stderr)
@@ -52,8 +54,8 @@ def parse_arguments():
 ### Doesn't work right now, must launch .sh separately and then run functional tests on produced results
 def launch_nextflow(script):
 
-    script_file = os.path.abspath(script)
-    script_dir = os.path.dirname(script_file)
+    script_file = path.abspath(script)
+    script_dir = path.dirname(script_file)
 
     print('Launching test run with the provided file:\n\n{}\n'.format(script_file))
 
@@ -61,156 +63,49 @@ def launch_nextflow(script):
 
     print('Test run completed')
 
-# Lists of output files to compare
-## 01_clean_qc:
-global _01_clean_qc = [
-    ('01_1_cleaned_reads/logs/a.no_filter.flagstat', 'diff'),
-    ('01_1_cleaned_reads/logs/c.no_filter.flagstat', 'diff'),
-    ('01_1_cleaned_reads/logs/a_cutadapt.log', 'cut_diff'),
-    ('01_1_cleaned_reads/logs/c_cutadapt.log', 'cut_diff'),
-    ('01_1_cleaned_reads/logs/a_sickle.log', 'diff'),
-    ('01_1_cleaned_reads/logs/c_sickle.log', 'diff'),
-    ('01_1_cleaned_reads/logs/host_filter_flagstat/a.host_filter.flagstat', 'diff'),
-    ('01_1_cleaned_reads/logs/host_filter_flagstat/c.host_filter.flagstat', 'diff'),
-    ('01_2_qc/fastqc_cleaned/cleaned_a/cleaned_a_R1_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_c/cleaned_c_R1_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_a/cleaned_a_R2_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_c/cleaned_c_R2_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_a/cleaned_a_R1_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_c/cleaned_c_R1_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_a/cleaned_a_R2_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_cleaned/cleaned_c/cleaned_c_R2_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_raw/a/a_R1_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_raw/c/c_R1_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_raw/a/a_R2_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_raw/c/c_R2_fastqc.zip', 'not_empty'),
-    ('01_2_qc/fastqc_raw/a/a_R1_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_raw/c/c_R1_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_raw/a/a_R2_fastqc.html', 'not_empty'),
-    ('01_2_qc/fastqc_raw/c/c_R2_fastqc.html', 'not_empty'),
-    ('01_3_taxonomic_affiliation_reads/a.krona.html', 'not_empty'),
-    ('01_3_taxonomic_affiliation_reads/c.krona.html', 'not_empty'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_class.tsv', 'diff'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_family.tsv', 'diff'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_genus.tsv', 'diff'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_order.tsv', 'diff'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_phylum.tsv', 'diff'),
-    ('01_3_taxonomic_affiliation_reads/taxo_affi_reads_species.tsv', 'diff')
-]
-
-## 02_assembly:
-global _02_assembly 
-_02_assembly = [
-    ('logs/a.count_reads_on_contigs.flagstat', 'diff'),
-    ('logs/c.count_reads_on_contigs.flagstat', 'diff'),
-    ('logs/a.count_reads_on_contigs.idxstats', 'diff'),
-    ('logs/c.count_reads_on_contigs.idxstats', 'diff'),
-    ('a_metaspades/a_scaffolds.fasta', 'diff'),
-    ('c_metaspades/c_scaffolds.fasta', 'diff'),
-    ('a_megahit/a_scaffolds.fasta', 'diff'),
-    ('c_megahit/c_scaffolds.fasta', 'diff'),
-    ('a_all_contigs_QC/report.tsv', 'diff'),
-    ('c_all_contigs_QC/report.tsv', 'diff'),
-    ('a_all_contigs_QC/report.html', 'not_empty'),
-    ('c_all_contigs_QC/report.html', 'not_empty')
-]
-
-## 03_filtering
-global _03_filtering 
-_03_filtering = [
-    ('a_select_contigs_cpm10.fasta', 'diff'),
-    ('c_select_contigs_cpm10.fasta', 'diff'),
-    ('a_discard_contigs_cpm10.fasta', 'diff'),
-    ('c_discard_contigs_cpm10.fasta', 'diff'),
-    ('a_select_contigs_QC/report.tsv', 'diff'),
-    ('c_select_contigs_QC/report.tsv', 'diff'),
-    ('a_select_contigs_QC/report.html', 'not_empty'),
-    ('c_select_contigs_QC/report.html', 'not_empty')
-]
-
-## 04_structural_annot
-global _04_structural_annot
-_04_structural_annot = [
-    ('a.annotated.faa', 'diff'),
-    ('c.annotated.faa', 'diff'),
-    ('a.annotated.ffn', 'diff'),
-    ('c.annotated.ffn', 'diff'),
-    ('a.annotated.fna', 'diff'),
-    ('c.annotated.fna', 'diff'),
-    ('a.annotated.gff', 'diff'),
-    ('c.annotated.gff', 'diff'),
-    ('a_prot.len', 'diff'),
-    ('c_prot.len', 'diff')
-]
-
-
-## 05_alignment
-global _05_alignment
-_05_alignment = [
-    ('05_1_reads_alignment_on_contigs/a/a_contig.bed', 'diff'),
-    ('05_1_reads_alignment_on_contigs/c/c_contig.bed', 'diff'),
-    ('05_1_reads_alignment_on_contigs/a/a.sort.bam.idxstats', 'diff'),
-    ('05_1_reads_alignment_on_contigs/c/c.sort.bam.idxstats', 'diff'),
-    ('05_1_reads_alignment_on_contigs/a/a.regions.bed.gz', 'zdiff'),
-    ('05_1_reads_alignment_on_contigs/c/c.regions.bed.gz', 'zdiff'),
-    ('05_2_database_alignment/a/a_aln_diamond.m8', 'diff'),
-    ('05_2_database_alignment/c/c_aln_diamond.m8', 'diff')
-]
-
-# ## 06_func_annot
-# global _06_func_annot = [
-
-# ]
-
-# ## 07_taxo_affi
-# global _07_taxo_affi = [
-
-# ]
+# Load JSON file containing list of files to check
+## (this .json file must be located in the same directory as 'functions.py')
+def json_load(step):
 
-# Do file comparisons for given step and write output
-def check_files(exp_dir, obs_dir, step):
-
-    if not os.path.exists(exp_dir) or not os.path.exists(obs_dir):
-        sys.exit('{} or {} folder(s) do not exist, please check --exp_dir and --obs_dir parameters'.format(exp_dir, obs_dir))
-
-    if step == '01_clean_qc':
-
-        files_list = _01_clean_qc
-
-    elif step == '02_assembly':
-
-        files_list = _02_assembly
-
-    elif step == '03_filtering':
-
-        files_list = _03_filtering
+    with open(path.join(path.dirname(path.realpath(sys.argv[0])), 'files_to_test.json'), 'r') as json_file:
+        json_obj = json.load(json_file)
+        json_file.close()
 
-    elif step == '04_structural_annot':
+    files_list = json_obj[step]
 
-        files_list = _04_structural_annot
+    return files_list
 
-    elif step == '05_alignment':
-
-        files_list = _05_alignment
-
-    # elif step == '06_func_annot':
-
-    #     files_list = _06_func_annot
+# Do file comparisons for given step and write output
+def check_files(exp_dir, obs_dir, step, sampleIds):
 
-    # elif step == '07_taxo_affi':
+    # Check existence of expected and observed directories
+    if not path.exists(exp_dir) or not path.exists(obs_dir):
+        sys.exit('{a} or {b} folder(s) do not exist, please check --exp_dir and --obs_dir parameters'.format(a = exp_dir, b = obs_dir))
 
-    #     files_list = _07_taxo_affi
+    # Load files and methods list from JSON file
+    files_list = json_load(step)
+    # print files_list, len(files_list)
+    # sys.exit()
 
-    # elif step == '08_binning':
+    # Load list of sample ids given by user
+    sampleIds_list = sampleIds.split(',')
 
-    #     files_list = _08_binning
+    # Initiate log for untested files (removes already existing logs)
+    not_tested_log = 'ft_{}.not_tested'.format(step)
+    os.remove(not_tested_log) if path.exists(not_tested_log) else None
 
     log = open('ft_{}.log'.format(step), 'w+')
 
-    expected_prefix = '{}/{}/'.format(os.path.abspath(exp_dir), step)
-    observed_prefix = '{}/{}/'.format(os.path.abspath(obs_dir), step)
+    expected_prefix = path.join(path.abspath(exp_dir), step)
+    observed_prefix = path.join(path.abspath(obs_dir), step)
 
-    log.write('Expected directory: {}\nvs\nObserved directory: {}\n'.format(expected_prefix, observed_prefix))
+    log.write('Expected directory: {a}\nvs\nObserved directory: {b}\n'.format(a = expected_prefix, b = observed_prefix))
+
+    # r = re.compile('sampleId')
+    # samples_cnt = filter(r.match, sampleIds_list)
+    # sys.exit(samples_cnt)
+    # other_cnt
+    # max_cnt = len(files_list) * len(sampleIds_list)
 
     max_cnt = len(files_list)
 
@@ -221,59 +116,43 @@ def check_files(exp_dir, obs_dir, step):
 
     print('\nLaunching {}...\n'.format(step))
 
-    for file in files_list:
+    for file_method in files_list:
 
-        file_path = file[0]
-        file_usage = file[1]
+        file_path = file_method['file']
+        file_method = file_method['method']
         
-        expected_path = '{}{}'.format(expected_prefix, file_path)
-        observed_path = '{}{}'.format(observed_prefix, file_path)
-        not_tested_log = 'ft_{}.not_tested'.format(step)
+        expected_path = path.join(expected_prefix, file_path)
+        observed_path = path.join(observed_prefix, file_path)
 
         # Make log of non existing files
-        if not os.path.exists(expected_path):
-            nt = open(not_tested_log, 'a')
-            nt.write('Exp:\t' + expected_path + '\n')
-            nt.close()
-            nt_cnt += 1
-            max_cnt -= 1
-            file_out = '''
-------------------------------------------------------------------------------
-
-File:           {}
-Not tested (list in {})
-'''.format(file_path, not_tested_log)
-
-            log.write(file_out)
-            print(file_out)
-
-        elif not os.path.exists(observed_path):
+        if not path.exists(observed_path):
             nt = open(not_tested_log, 'a')
-            nt.write('Obs:\t' + observed_path + '\n')
+            nt.write(observed_path + '\n')
             nt.close()
             nt_cnt += 1
-            max_cnt -= 1
+            if max_cnt > 0:
+                max_cnt -= 1
             file_out = '''
 ------------------------------------------------------------------------------
 
-File:           {}
-Not tested (list in {})
-'''.format(file_path, not_tested_log)
+File:           {a}
+Not tested (list in {b})
+'''.format(a = file_path, b = not_tested_log)
             log.write(file_out)
             print(file_out)
 
-        else:
+        if path.exists(expected_path) and path.exists(observed_path):
 
-            test, out = test_method(expected_path, observed_path, file_usage)
+            test, out = test_method(expected_path, observed_path, file_method)
 
             if test == False:
                 file_out = '''
 ------------------------------------------------------------------------------
 
-File:           {}
-Test method:    {}
+File:           {a}
+Test method:    {b}
 
-'''.format(file_path, file_usage)
+'''.format(a = file_path, b = file_method)
                 log.write(file_out)
                 print(file_out)
                 log.write(out)
@@ -283,9 +162,9 @@ Test method:    {}
                 file_out = '''
 ------------------------------------------------------------------------------
 
-File:           {}
-Test method:    {}
-'''.format(file_path, file_usage)
+File:           {a}
+Test method:    {b}
+'''.format(a = file_path, b = file_method)
 
                 log.write(file_out)
                 print(file_out)
@@ -294,10 +173,17 @@ Test method:    {}
 
             continue
 
-    true_perc = round((float(true_cnt) / float(max_cnt) * 100), 2)
-    if false_cnt != 0:
-        false_perc = round(100 - (float(true_cnt) / float(max_cnt) * 100), 2)
+    if max_cnt != 0:
+        if true_cnt != 0:
+            true_perc = round((float(true_cnt) / float(max_cnt) * 100), 2)
+        else:
+            true_perc = float(0)
+        if false_cnt != 0:
+            false_perc = round(100 - (float(true_cnt) / float(max_cnt) * 100), 2)
+        else:
+            false_perc = float(0)
     else:
+        true_perc = float(0)
         false_perc = float(0)
 
     out = '''
@@ -334,10 +220,18 @@ def test_method(exp_path, obs_path, method):
             YES = 1
             command = 'diff <(tail -n+6 {}) <(tail -n+6 {})'.format(exp_path, obs_path)
 
-        elif method == 'zdiff':
+        elif method == 'no_header_diff':
             YES = 2
+            command = 'diff <(grep -w "^#" {}) <(grep -w "^#" {})'.format(exp_path, obs_path)
+
+        elif method == 'zdiff':
+            YES = 3
             command = 'zdiff {} {}'.format(exp_path, obs_path)
 
+        elif method == 'taxo_diff':
+            YES = 4
+            command = 'diff <(cut -f1 {} | sort) <(cut -f1 {} | sort)'.format(exp_path, obs_path)
+
         process = subprocess.Popen(command, stdout = subprocess.PIPE, shell = True, executable = '/bin/bash')
         diff_out, error = process.communicate()
 
@@ -359,8 +253,8 @@ def test_method(exp_path, obs_path, method):
         return test, out
 
     elif method == 'not_empty':
-        YES = 3
-        test = os.path.getsize(obs_path) > 0
+        YES = 5
+        test = path.getsize(obs_path) > 0
 
         if test:
             test = True

functional_tests/main.py

@@ -63,7 +63,7 @@ def main():
             if steps_list[step] <= steps_list[args.step]:
 
                 # Launch test on expected and observed files from this step
-                out = check_files(args.exp_dir, args.obs_dir, step)
+                out = check_files(args.exp_dir, args.obs_dir, step, args.sampleIds)
                 outs.append(out)
 
         print(''.join(outs))

main.nf

@@ -75,7 +75,8 @@
        
      07_taxo_affi options:
        --accession2taxid             FTP adress of file prot.accession2taxid.gz. Default: "ftp://ftp.ncbi.nih.gov/pub/taxonomy/accession2taxid/prot.accession2taxid.gz".
-       --taxdump                     FTP adress of file taxdump.tar.gz. Default "ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz".
+       --taxdump                     FTP adress of file taxdump.tar.gz. Default: "ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz".
+       --taxonomy_dir                Directory if taxdump and accession2taxid already downloaded ("PATH/directory").
 
      08_binning options:
        --min_contig_size [cutoff]    Contig length cutoff to filter contigs before binning. Must be greater than 1500. Default: 1500.
@@ -408,13 +409,9 @@ if (!params.skip_kaiju && ('01_clean_qc' in step || '02_assembly' in step || '03
 
       output:
       file("nodes.dmp") into index_kaiju_nodes_ch
-      file("kaiju_db*.fmi") into index_kaiju_db_ch, index_kaiju_db_size_ch
+      file("*.fmi") into index_kaiju_db_ch
       file("names.dmp") into index_kaiju_names_ch
 
-      // file("kaiju_db(?:_refseq|).fmi") into index_kaiju_db_ch
-      // .value(kaiju_Path + "/" + kaiju_Path_db + "/kaiju_db(?:_refseq|).fmi")
-
-
       script:
       """
       wget ${database}
@@ -425,12 +422,17 @@ if (!params.skip_kaiju && ('01_clean_qc' in step || '02_assembly' in step || '03
       """
     } } else {
       if(params.kaiju_db_dir) {
-          index_kaiju_nodes_ch  = Channel
-              .value(params.kaiju_db_dir + "/nodes.dmp")
-          index_kaiju_db_ch = Channel
-              .value(params.kaiju_db_dir + "/kaiju_db*.fmi")
-          index_kaiju_names_ch = Channel
-              .value(params.kaiju_db_dir + "/names.dmp")
+          if(file(params.kaiju_db_dir + "/kaiju_db*.fmi").size == 1) {
+            index_kaiju_nodes_ch  = Channel
+                .value(params.kaiju_db_dir + "/nodes.dmp")
+            index_kaiju_db_ch = Channel
+                .value(params.kaiju_db_dir + "/kaiju_db*.fmi")
+            index_kaiju_names_ch = Channel
+                .value(params.kaiju_db_dir + "/names.dmp")
+          }
+          else {
+            exit 1, "There are more than one file ending with .fmi in ${params.kaiju_db_dir}"
+          }
       }
       else {
           if (!(params.kaiju_db) & !(params.kaiju_db_dir) & (!params.skip_kaiju)){
@@ -439,13 +441,13 @@ if (!params.skip_kaiju && ('01_clean_qc' in step || '02_assembly' in step || '03
       }
     }
 
-  // if {
+// if {
 // items = Channel.from(analysis_config.items.keySet())
 
 // for (String item : items) {
 //     list_of_items_to_process << item
 //     } 
-  // }
+// }
 
   // Kaiju.
   process kaiju {
@@ -482,7 +484,7 @@ if (!params.skip_kaiju && ('01_clean_qc' in step || '02_assembly' in step || '03
     Generate_barplot_kaiju.py -i ${sampleId}_kaiju_MEM_verbose.out
     """
   }
-  // Merge kaiju results by species
+  // Merge kaiju results by taxonomic ranks
   process kaiju_merge{
     tag "${sampleId}"
     publishDir "${params.outdir}/01_clean_qc/01_3_taxonomic_affiliation_reads", mode: 'copy'
@@ -536,7 +538,7 @@ else {
 
 // Metaspades.
 if(params.assembly=='metaspades') {
-  megahit_ch = Channel.from(false)
+  // megahit_ch = Channel.from(false)
   process metaspades {
     tag "${sampleId}"
     publishDir "${params.outdir}/02_assembly", mode: 'copy'
@@ -560,7 +562,7 @@ if(params.assembly=='metaspades') {
   }
 } else { // Megahit.
   if(params.assembly=='megahit') {
-    metaspades_ch = Channel.from(false)
+    // metaspades_ch = Channel.from(false)
     process megahit {
       tag "${sampleId}"
       publishDir "${params.outdir}/02_assembly", mode: 'copy'
@@ -925,11 +927,11 @@ if(params.eggnogmapper_db) {
     script:
     """
     mkdir db_eggnog_mapper
-    /eggnog-mapper-2.0.4-rf1/download_eggnog_data.py -P -M -f -y --data_dir db_eggnog_mapper
+    /eggnog-mapper-2.0.4-rf1/download_eggnog_data.py -P -f -y --data_dir db_eggnog_mapper
     """
     } } else {
       if(params.eggnog_mapper_db_dir) {
-          functional_annot_db_ch = Channel.value(params.eggnog_mapper_db_dir)
+          functional_annot_db_ch = Channel.fromPath(params.eggnog_mapper_db_dir).first()
       }
         else {
             if (!(params.eggnogmapper_db) & !(params.eggnog_mapper_db_dir) & "06_func_annot" in step){
@@ -974,7 +976,7 @@ process best_hits_diamond {
 
     script:
     """
-    best_bitscore_diamond.py -o ${sampleId}.best_hit ${diamond_file}
+    filter_diamond_hits.py -o ${sampleId}.best_hit ${diamond_file}
     """
 }
 // Merge eggNOG-mapper output files and quantification table.
@@ -1035,35 +1037,44 @@ process make_functional_annotation_tables {
 
  // TAXONOMIC AFFILIATION OF CONTIGS.
 
- // Load taxonomy.
+ // Download taxonomy if taxonomy_dir is not given.
+if(!params.taxonomy_dir) {
   process download_taxonomy_db {
 
-   when:
-   ('07_taxo_affi' in step)
-
-   input:
-   val accession2taxid_ch
-   val taxdump_ch
-
-   output:
-   set file("*taxid*"), file ("*taxdump*") into taxonomy_ch
+  when:
+  ('07_taxo_affi' in step)
 
-   script:
-   """
-   wget ${accession2taxid_ch}
-   file='${accession2taxid_ch}'
-   fileName=\${file##*/}
-   echo \$fileName
-   gunzip \$fileName
-   wget ${taxdump_ch}
-   file_taxdump='${taxdump_ch}'
-   fileName_taxdump=\${file_taxdump##*/}
-   echo \$fileName_taxdump
-   mkdir taxdump; mv \$fileName_taxdump taxdump; cd taxdump ; tar xzvf \$fileName_taxdump
-   """
- }
+  input:
+  val accession2taxid_ch
+  val taxdump_ch
 
+  output:
+  set file("*taxid*"), file ("*taxdump*") into taxonomy_ch
 
+  script:
+  """
+  wget ${accession2taxid_ch}
+  file='${accession2taxid_ch}'
+  fileName=\${file##*/}
+  echo \$fileName
+  gunzip \$fileName
+  wget ${taxdump_ch}
+  file_taxdump='${taxdump_ch}'
+  fileName_taxdump=\${file_taxdump##*/}
+  echo \$fileName_taxdump
+  mkdir taxdump; mv \$fileName_taxdump taxdump; cd taxdump ; tar xzvf \$fileName_taxdump
+  """
+  }
+}
+else if(params.taxonomy_dir) {
+  assert file(params.taxonomy_dir + '/prot.accession2taxid').exists()
+  assert file(params.taxonomy_dir + '/taxdump').exists()
+  taxonomy_ch = Channel
+      .tuple(file(params.taxonomy_dir + '/prot.accession2taxid'), file(params.taxonomy_dir + '/taxdump'))
+}
+else {
+  exit 1, "You must specify --accession2taxid and --taxdump or --taxonomy_dir"
+}
 
 /*
  * Create channel with sample id, diamond files and desman length files, idxstats and depth files.
@@ -1080,7 +1091,7 @@ process diamond_parser {
   when: ('07_taxo_affi' in step)
 
   input:
-  set file(prot_accession2taxid), file(taxonomy) from taxonomy_ch
+  set file(accession2taxid), file(taxdump) from taxonomy_ch
   set sampleId, file(diamond_file), file(prot_len), file(idxstats), file(depth)  from diamond_parser_input_ch
 
   output:
@@ -1099,7 +1110,7 @@ process diamond_parser {
 
   script:
   """
-  aln2taxaffi.py -a ${prot_accession2taxid} --taxonomy ${taxonomy} -o ${sampleId} ${diamond_file} ${prot_len}
+  aln2taxaffi.py -a ${accession2taxid} --taxonomy ${taxdump} -o ${sampleId} ${diamond_file} ${prot_len}
   merge_contig_quantif_perlineage.py -i ${idxstats} -c ${sampleId}.percontig.tsv -m ${depth} -o ${sampleId}_quantif_percontig
   """
 }

nextflow.config

@@ -36,6 +36,7 @@ params {
     diamond_bank = ""
     accession2taxid = "ftp://ftp.ncbi.nih.gov/pub/taxonomy/accession2taxid/prot.accession2taxid.gz"
     taxdump = "ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz"
+    taxonomy_dir = false
     eggnogmapper_db = false
     eggnog_mapper_db_dir = false
     multiqc_config = "$baseDir/assets/multiqc_config.yaml"

test/host.fasta

@@ -4,4 +4,4 @@ TTTCCGCATCTAAAANATATCAGTATTGCTTGTGTCNGACTGATATAATAAAAATAGCTGACAATCAAAAGATTATCAGC
 CATTCTGTGTACCCGAGATCGTGCTCGAACCAACTACGGTGTTACACCACTAGAACCTGATACTAGCGCT
 GCACACACGGTGGAATGAATGTGCCGGCAGACAAATGTGTTGAGTATAACACGATGGATGCAATCGCAAA
 TGGAATGAGTA
-AGACAAAAATAGACAATCAAGATAATTCTGTAGATCCTAAAACTAAAAACGGACACGGACAGAGGTA
+AGACAAAAATAGACAATCAAGATAATTCTGTAGATCCTAAAACTAAAAACGGACACGGACAGAGGTA
\ No newline at end of file