host.fasta 389 Bytes
Newer Older
1
2
3
4
5
6
>chr1
CAAACGGCAACTATCNTACGGACAAAGAGGTATCTCNCCACAAGGATTCGTGGAAACCGTACGGAACCCCAGATCCGCAT
TTTCCGCATCTAAAANATATCAGTATTGCTTGTGTCNGACTGATATAATAAAAATAGCTGACAATCAAAAGATTATCAGC
CATTCTGTGTACCCGAGATCGTGCTCGAACCAACTACGGTGTTACACCACTAGAACCTGATACTAGCGCT
GCACACACGGTGGAATGAATGTGCCGGCAGACAAATGTGTTGAGTATAACACGATGGATGCAATCGCAAA
TGGAATGAGTA
7
AGACAAAAATAGACAATCAAGATAATTCTGTAGATCCTAAAACTAAAAACGGACACGGACAGAGGTA