D-GENIES issueshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues2018-07-12T17:07:54+02:00https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/15Zoom en sélectionnant la zone à zoomer2018-07-12T17:07:54+02:00Floreal CabanettesZoom en sélectionnant la zone à zoomer1.2Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/115Windows compatibility2018-02-22T10:55:48+01:00Floreal CabanettesWindows compatibilityCheck program is compatible for windows in standalone mode, and make required changes to make it compatible.Check program is compatible for windows in standalone mode, and make required changes to make it compatible.1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/44Vérifier que les fichiers fasta fournis sont valides2017-12-05T17:15:49+01:00Floreal CabanettesVérifier que les fichiers fasta fournis sont valides=> Fichiers non vides
=> Format fasta correct=> Fichiers non vides
=> Format fasta correct1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/131Update doc for 1.1 version2018-04-12T17:33:06+02:00Floreal CabanettesUpdate doc for 1.1 version- New run form
- Export backup in menu
- Export SVG/PNG keep the zoom- New run form
- Export backup in menu
- Export SVG/PNG keep the zoom1.1Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/5Trier les zones2017-10-25T11:45:22+02:00Floreal CabanettesTrier les zonesTrier les zones pour les mettre dans l'ordre des maps.
Tri par poids moyen : carré de la taille, pondérer en fonction de la qualité.Trier les zones pour les mettre dans l'ordre des maps.
Tri par poids moyen : carré de la taille, pondérer en fonction de la qualité.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/73Timeout if sort is too long2017-11-14T17:23:18+01:00Floreal CabanettesTimeout if sort is too longAs sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc.....As sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc...)
- Make it asynchronous:
- By a websocket connection. If chosen, could also be used for the status page
- By a regular server call by the client (it's not the best choice... :-( )
- Make the sort on job launch and save it. Just load it on click on the sort button. Solves the problem, but job takes more time (juste few seconds in general...) and the server could do it while the user will never want the sorted version.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/47Test on very small sequences2017-11-08T17:50:51+01:00Christophe KloppTest on very small sequencestest on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTAC...test on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTACAGGTTATGCGGTCCCAACGCTTGAGGCCTCC
TCCCAGCCTTACAGTCCTGAGGGAGAGGGAAGTAGAATAGCACAAGTCCAGCCACAGTATCATGAGCCCTTGTCTGGGGAACCCCATCTCCTGGGTGACC
ATTCATACATCCAGTACCTCATGCATATGAGCCCCCACTAGAGATGTACCTTCTAATGCAAGTCACGCGCGGAATCCCGCTGCGTCTTGCAGTCCCCTGA
ATATGCACGGATATCCGCAGCGTCTCATCATACCCATGAAGATGCGCGGTTATCCGCAGCGCCTCATCATCCCCATGAACATGTGCGGTTATCCGCAGCG
CCTCATCATCCCCATGAGCACGCGCGGTTATCCGCAGCATCTCGCCATGCCCCGGAGTTTTCGCAGACGCCCATTGCGACCTATGGCTCATCTGGAGATG
TGCAGCTGCCTGTGGTGCGGTACAATCCTCAAGACTATGCTGCACTACCAGCCAGTTCCAGCCACCCGACCGTCCGGAATAGACCTAGATATAAGGATCT
CCGCTATGATGGCAAGTGCAACTTGAAAGCCTTCCTTCATAAATTTGTTCGCCAACAGTGGAATGAGACCGAGCAACATGATCAATTCTGTTTCTTTCTG
GAGGGCCCGGCCATTGAGTATTACACTTTGATGCTGGAGACTACCCCGCCTGAGGTTCAGCGAAATACTCAGGAAGTTTGACAAGCGCTTTGGCTCATCA
==> Mitochodrion2.fasta <==
>utg2733 length=28457 nodes=17
TCACCCTGCCCCAACTCCGTTTTCTACAATGTTAGACATAAGCATAAGATAAAGAGACCCTGGCAAAACTCAAAATCTAAATGCATTAATCGAGGGAAAT
TGCATGTCTGCTACTAGAAGCATCAAAGGGATAAGCCAGTTACCAAACCCCCCAATTATTACAGGTATAACAAAGAAAAAAATCATAACCAACGCATGCC
TAGTTACAACTGCATTATAAGTCACGGGGTCTAAAACTTAGCTCCAGGGTTATAAAGTCTCCAACGAAATAAGAGACCTAAACCTAGTTCCCGCAAGAAC
AGCTCAAAATCCAAATACTATATAAAACCTTCCAATGTCTAAATGATTGTTGACATAAATGTCCCCCGCTTTTCAAAAAGAAGAACTGGACAAGGGAAAA
ACACTTTTAAGGAGCGAACCTTTTAAAAAACTTTAATTCCTGGTGAATCATTATTCTTAGACCAACCCAATTATGAGTAGTTTCAAATTTGAAGTTTGAC
AGTTTAATCCTTAACTTATGGTCCAAAGCACTCTGAGAGTACAAAGAGTACACTCCAGAGTCAGATTACGTAAGATACCTACTATCAAACTAAGCCCCAA
AGATGTTTCACACGCGACTAAAACAAGAAAAACGAATAGCCTATGACTGCTATCCATCCCTGACAGCAAATTAGTATACCACCTAGACTGACACATACGC
CCTCTATTAAAATAAGGTATCTAAGGAAGTTAGAAACTTCTTAAGTATTGCCCCAATAACCACCCAAAAAACCATAGTAAATAAAGCTATTGACCTCTTT
GTCATTTTAAATTTTATAATAAAAAAAAATACACAGTAATTCCTAAAACAAACGGCAGCAGTGTCTTTCAAGCTGCTATCATCAATTGATCATATCGAAA
Job name: issVq_20171107162307
Your job has failed. Please try again.
If the problem persists, please contact the support.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/32Test Homme VS Singe => passe en mémoire ?2017-11-09T17:35:00+01:00Floreal CabanettesTest Homme VS Singe => passe en mémoire ?Si non, quelles sont les ressources nécessaires ?Si non, quelles sont les ressources nécessaires ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/111Summary: fail for big data: timeout2018-01-31T15:12:42+01:00Floreal CabanettesSummary: fail for big data: timeout1.0Floreal CabanettesFloreal Cabanettes2018-02-02https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/113Summary stats failed on big data2018-02-02T16:23:06+01:00Floreal CabanettesSummary stats failed on big dataHuman VS Chimp for example.
Too much memory is used, it make the server unresponding...
Fixes propals:
- Change the algorithm to use less memory
- Make summary on job run, save it and just show it on button clickHuman VS Chimp for example.
Too much memory is used, it make the server unresponding...
Fixes propals:
- Change the algorithm to use less memory
- Make summary on job run, save it and just show it on button click1.0Floreal CabanettesFloreal Cabanettes2018-02-09https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/34Stockage des données sous forme compressée2018-02-07T10:34:13+01:00Floreal CabanettesStockage des données sous forme compressée=> Il faut inciter les utilisateurs a utiliser un format compressé=> Il faut inciter les utilisateurs a utiliser un format compressé1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/25Status : auto-refresh page periodically2017-11-28T18:26:44+01:00Floreal CabanettesStatus : auto-refresh page periodically1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/24Status : add a bar that progress when job progress2017-11-28T18:26:44+01:00Floreal CabanettesStatus : add a bar that progress when job progress1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/117Standalone version: problem with treatments which requires mail2018-02-16T14:08:51+01:00Floreal CabanettesStandalone version: problem with treatments which requires mailTwo possibilities:
- disable them on standalone version
- change code to be compatible withTwo possibilities:
- disable them on standalone version
- change code to be compatible with1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/114Standalone version2018-02-08T17:44:09+01:00Floreal CabanettesStandalone versionTo launch D-Genies on a local computer, with only 1 user.To launch D-Genies on a local computer, with only 1 user.1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/71Split of contigs: when to do that?2017-12-05T15:02:08+01:00Floreal CabanettesSplit of contigs: when to do that?On big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automaticallyOn big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automatically1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/104Sort: still store sorted version on unsort2018-01-29T15:31:00+01:00Floreal CabanettesSort: still store sorted version on unsortJust set if current vision is sorted or not (.sorted file)Just set if current vision is sorted or not (.sorted file)1.0Floreal CabanettesFloreal Cabanettes2018-01-19https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/118Sometimes (on windows at least) flask is really long to start. Check flask is...2018-02-15T14:12:14+01:00Floreal CabanettesSometimes (on windows at least) flask is really long to start. Check flask is already started before launch the browser1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/88Si on met le même id plus de 2 fois dans la soumission d'un job, ça plante (o...2017-12-05T17:25:12+01:00Floreal CabanettesSi on met le même id plus de 2 fois dans la soumission d'un job, ça plante (on passe pas à _3)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/22Show size of fasta files before upload2018-01-04T13:51:24+01:00Floreal CabanettesShow size of fasta files before upload1.0Floreal CabanettesFloreal Cabanettes