D-GENIES issueshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues2017-10-26T18:14:16+02:00https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/1Permettre l'input d'un seul fasta et faire de l'auto-alignement2017-10-26T18:14:16+02:00Floreal CabanettesPermettre l'input d'un seul fasta et faire de l'auto-alignementUtiliser l'option minimap :
-X skip self and dual mappings (for the all-vs-all mode)Utiliser l'option minimap :
-X skip self and dual mappings (for the all-vs-all mode)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/2Analyser le fasta avant de lancer l'alignement pour éviter les traitements tr...2018-01-25T15:34:56+01:00Floreal CabanettesAnalyser le fasta avant de lancer l'alignement pour éviter les traitements trop longs ou donnant des résultats inexploitablesÉviter d'avoir trop de contigs de petite taille. Il faudra faire des tests pour définir les valeurs limitesÉviter d'avoir trop de contigs de petite taille. Il faudra faire des tests pour définir les valeurs limites1.0Floreal CabanettesFloreal Cabanettes2018-01-19https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/3Ajouter la possibilité de sélectionner la zone à afficher à partir de 2 listes2017-10-27T10:57:04+02:00Floreal CabanettesAjouter la possibilité de sélectionner la zone à afficher à partir de 2 listesLes 2 listes sont ajoutées dans le bandeau à droite (ou peut être placé en bas éventuellement)Les 2 listes sont ajoutées dans le bandeau à droite (ou peut être placé en bas éventuellement)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/4Bug de la stroke width des maps lors du changement d'identité minimale2017-10-26T16:42:14+02:00Floreal CabanettesBug de la stroke width des maps lors du changement d'identité minimaleSi on a sélectionné une zone et qu'on change l'identité minimale, l'épaisseur des traits devient incorrecte.Si on a sélectionné une zone et qu'on change l'identité minimale, l'épaisseur des traits devient incorrecte.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/5Trier les zones2017-10-25T11:45:22+02:00Floreal CabanettesTrier les zonesTrier les zones pour les mettre dans l'ordre des maps.
Tri par poids moyen : carré de la taille, pondérer en fonction de la qualité.Trier les zones pour les mettre dans l'ordre des maps.
Tri par poids moyen : carré de la taille, pondérer en fonction de la qualité.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/6Réglette intensité des limites de chromosomes2017-10-26T17:18:30+02:00Floreal CabanettesRéglette intensité des limites de chromosomesPour changer l'intensité de ces limitesPour changer l'intensité de ces limites1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/7Ajout de l'export2017-11-10T17:21:24+01:00Floreal CabanettesAjout de l'exportAjouter l'export au format :
* svg
* png
* PAF file
Pour SVG et PNG : soit toute l'image soit seulement l'image affichée. Pareil pour PAF ?Ajouter l'export au format :
* svg
* png
* PAF file
Pour SVG et PNG : soit toute l'image soit seulement l'image affichée. Pareil pour PAF ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/8Fix window resize2017-10-26T16:12:16+02:00Floreal CabanettesFix window resizeLorsqu'on agrandit la zone de dessin plus que la taille d'origine, la barre de droite part en bas. Ce n'est pas attendu.Lorsqu'on agrandit la zone de dessin plus que la taille d'origine, la barre de droite part en bas. Ce n'est pas attendu.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/9Big genomes: filter to keep acceptable in memory2017-11-20T16:34:08+01:00Floreal CabanettesBig genomes: filter to keep acceptable in memoryPistes :
- Éliminer les plus petits matchs
- Définir un nombre de matchs maximal à afficher
- Filtre côté client ou serveur ? Je dirais serveur quand c'est vraiment très gros, sinon clientPistes :
- Éliminer les plus petits matchs
- Définir un nombre de matchs maximal à afficher
- Filtre côté client ou serveur ? Je dirais serveur quand c'est vraiment très gros, sinon client1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/10Add results to menu2017-10-26T18:14:02+02:00Floreal CabanettesAdd results to menuLes résultats sont ajoutés au menu "Results" quand ils sont chargés. Ils sont sauvés en cookies, et rechargés ensuite à partir des cookies.Les résultats sont ajoutés au menu "Results" quand ils sont chargés. Ils sont sauvés en cookies, et rechargés ensuite à partir des cookies.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/11Set files from URL instead of upload them2017-11-01T20:45:12+01:00Floreal CabanettesSet files from URL instead of upload themUse an URL in the form instead of download fileUse an URL in the form instead of download file1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/12Export : build fasta with sorted and re-ordonned (reversed or not) contigs2017-11-16T17:36:08+01:00Floreal CabanettesExport : build fasta with sorted and re-ordonned (reversed or not) contigsBuild it when we sort or flip contigs. Add it to export options thenBuild it when we sort or flip contigs. Add it to export options then1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/14Add possibility to undo a sort2017-10-25T11:16:10+02:00Floreal CabanettesAdd possibility to undo a sort1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/15Zoom en sélectionnant la zone à zoomer2018-07-12T17:07:54+02:00Floreal CabanettesZoom en sélectionnant la zone à zoomer1.2Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/16Add a tooltip to show current contig and target on cursor position2017-10-27T15:21:44+02:00Floreal CabanettesAdd a tooltip to show current contig and target on cursor position1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/17Implement support of compressed fasta files (*.gz)2017-10-30T17:38:02+01:00Floreal CabanettesImplement support of compressed fasta files (*.gz)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/18Add stats2018-01-15T18:08:02+01:00Floreal CabanettesAdd statsÇa serait bien d'avoir aussi une la liste des contigs de chaque fichier qui n'ont pas d'alignement et une synthèse des alignements du type 50% > 75% d'identité, 20% entre 50 et 75%..., pet-être sous la forme d'un graphique en barre comme...Ça serait bien d'avoir aussi une la liste des contigs de chaque fichier qui n'ont pas d'alignement et une synthèse des alignements du type 50% > 75% d'identité, 20% entre 50 et 75%..., pet-être sous la forme d'un graphique en barre comme dans jvenn, mais pour faire cela il ne faut prendre dans chaque carré que les alignements qui sont significatifs. Ceci permettrait de comparer des assemblages de manière globale...1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/97Concurrent jobs failed2018-01-12T14:21:32+01:00Floreal CabanettesConcurrent jobs failedIf we have a lot of jobs (more than 10), we have errors due to no correct update of the BDD. It happens with Sqlite. We must check with Mysql and check it solves the problem.If we have a lot of jobs (more than 10), we have errors due to no correct update of the BDD. It happens with Sqlite. We must check with Mysql and check it solves the problem.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/19Must fasta files be stored in gzipped format to keep space?2018-02-07T10:33:30+01:00Floreal CabanettesMust fasta files be stored in gzipped format to keep space?More time required to read them, but less space needed. Minimap can work with gzipped files!More time required to read them, but less space needed. Minimap can work with gzipped files!1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/20Ménage2017-11-20T11:10:07+01:00Floreal CabanettesMénageRemove old jobs (and failed jobs?)Remove old jobs (and failed jobs?)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/21Add example run2018-02-20T09:12:05+01:00Floreal CabanettesAdd example runAn example for test the app:
On avait aussi évoqué le fait de pouvoir mettre une URL en plus de l'upload: sur le même ligne.
On pourrait se servir de cette possibilité pour ajouter un bouton 'example' qui remplirait deux URL exemples. ...An example for test the app:
On avait aussi évoqué le fait de pouvoir mettre une URL en plus de l'upload: sur le même ligne.
On pourrait se servir de cette possibilité pour ajouter un bouton 'example' qui remplirait deux URL exemples. On pourrait utiliser deux génomes de champignons assez proches.
https://www.ncbi.nlm.nih.gov/genome/?term=saccharomyces
Afficher la vraie URL dans ce cas mais stocker l'exemple sur le serveur (ne pas le télécharger à chaque fois)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/22Show size of fasta files before upload2018-01-04T13:51:24+01:00Floreal CabanettesShow size of fasta files before upload1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/23Ajax uploading2017-11-01T20:45:12+01:00Floreal CabanettesAjax uploadingUse ajax to upload files and show progress bar of uploads (Use of JQuery file puload)Use ajax to upload files and show progress bar of uploads (Use of JQuery file puload)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/24Status : add a bar that progress when job progress2017-11-28T18:26:44+01:00Floreal CabanettesStatus : add a bar that progress when job progress1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/25Status : auto-refresh page periodically2017-11-28T18:26:44+01:00Floreal CabanettesStatus : auto-refresh page periodically1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/26Add max size for files and check it2017-12-18T11:17:33+01:00Floreal CabanettesAdd max size for files and check it1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/27Fix bug on small screens for run page2017-11-03T18:06:46+01:00Floreal CabanettesFix bug on small screens for run pageUse a table (responsive with bootstrap) instead of bootstrap divs #beurkUse a table (responsive with bootstrap) instead of bootstrap divs #beurk1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/28Gérer les erreurs d'upload2017-11-03T18:23:43+01:00Floreal CabanettesGérer les erreurs d'uploadEn cas d'erreur tout plante et c'est le drame :(En cas d'erreur tout plante et c'est le drame :(1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/29Send mail on job success/fail2017-11-07T17:20:06+01:00Floreal CabanettesSend mail on job success/failHistoire que le gars il entre pas son mail pour rien... :-)Histoire que le gars il entre pas son mail pour rien... :-)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/30Applications.properties & Wsgi file: change url to be valid in distributed pa...2017-11-02T17:10:29+01:00Floreal CabanettesApplications.properties & Wsgi file: change url to be valid in distributed package1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/31Identité : faire en absolu2017-11-02T17:51:43+01:00Floreal CabanettesIdentité : faire en absoluLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondanceLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondance1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/32Test Homme VS Singe => passe en mémoire ?2017-11-09T17:35:00+01:00Floreal CabanettesTest Homme VS Singe => passe en mémoire ?Si non, quelles sont les ressources nécessaires ?Si non, quelles sont les ressources nécessaires ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/33Distribution du programme2018-02-22T10:56:13+01:00Floreal CabanettesDistribution du programmeMettre à disposition l'outil :
- Via PIP
- Via AnacondaMettre à disposition l'outil :
- Via PIP
- Via Anaconda1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/34Stockage des données sous forme compressée2018-02-07T10:34:13+01:00Floreal CabanettesStockage des données sous forme compressée=> Il faut inciter les utilisateurs a utiliser un format compressé=> Il faut inciter les utilisateurs a utiliser un format compressé1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/35Export : ajout de l'export d'un tableau contenant les correspondances query-t...2017-11-20T16:13:19+01:00Floreal CabanettesExport : ajout de l'export d'un tableau contenant les correspondances query-target sur la diagonaleOption disponible que si le tri des contigs a été effectuéOption disponible que si le tri des contigs a été effectué1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/36Export : exporter les contigs assemblés selon la référence2018-02-06T11:39:52+01:00Floreal CabanettesExport : exporter les contigs assemblés selon la référenceOn assemble les contigs qui se suivent dans le chromosome (on prend la diagonale), séparés entre eux (dans le même chromosome) de 100N. Pas de N entre les contigs associés à 2 chromosomes différents.
On se retrouve avec autant de "conti...On assemble les contigs qui se suivent dans le chromosome (on prend la diagonale), séparés entre eux (dans le même chromosome) de 100N. Pas de N entre les contigs associés à 2 chromosomes différents.
On se retrouve avec autant de "contigs assemblés" que de chromosomes1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/37Check of uploaded extension not done (or does not cause any error)2017-11-03T11:05:12+01:00Floreal CabanettesCheck of uploaded extension not done (or does not cause any error)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/38Add global exception handler to catch all exception and pass job on error eve...2017-11-08T17:46:31+01:00Floreal CabanettesAdd global exception handler to catch all exception and pass job on error every time1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/39Do the index after the map, if this one has not failed2017-11-03T16:09:28+01:00Floreal CabanettesDo the index after the map, if this one has not failed1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/40Formulaire de contact2018-02-19T16:39:55+01:00Floreal CabanettesFormulaire de contactC'est quand même mieux qu'un mailto x)C'est quand même mieux qu'un mailto x)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/41If we have too small blocks on contigs or target, too much memory used becaus...2017-11-03T16:01:46+01:00Floreal CabanettesIf we have too small blocks on contigs or target, too much memory used because of too much break linesNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionnerNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionner1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/42Check extensions of files before upload (for local files)2017-11-06T11:11:56+01:00Floreal CabanettesCheck extensions of files before upload (for local files)Couldn't be done for URLs as we not always know name of files from URLCouldn't be done for URLs as we not always know name of files from URL1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/43Handle memory exception from minimap2017-11-17T17:22:28+01:00Floreal CabanettesHandle memory exception from minimapAs minimap says there is a lack of memory, report it to the user (not directly it, say to it its data are too big...)As minimap says there is a lack of memory, report it to the user (not directly it, say to it its data are too big...)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/44Vérifier que les fichiers fasta fournis sont valides2017-12-05T17:15:49+01:00Floreal CabanettesVérifier que les fichiers fasta fournis sont valides=> Fichiers non vides
=> Format fasta correct=> Fichiers non vides
=> Format fasta correct1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/47Test on very small sequences2017-11-08T17:50:51+01:00Christophe KloppTest on very small sequencestest on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTAC...test on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTACAGGTTATGCGGTCCCAACGCTTGAGGCCTCC
TCCCAGCCTTACAGTCCTGAGGGAGAGGGAAGTAGAATAGCACAAGTCCAGCCACAGTATCATGAGCCCTTGTCTGGGGAACCCCATCTCCTGGGTGACC
ATTCATACATCCAGTACCTCATGCATATGAGCCCCCACTAGAGATGTACCTTCTAATGCAAGTCACGCGCGGAATCCCGCTGCGTCTTGCAGTCCCCTGA
ATATGCACGGATATCCGCAGCGTCTCATCATACCCATGAAGATGCGCGGTTATCCGCAGCGCCTCATCATCCCCATGAACATGTGCGGTTATCCGCAGCG
CCTCATCATCCCCATGAGCACGCGCGGTTATCCGCAGCATCTCGCCATGCCCCGGAGTTTTCGCAGACGCCCATTGCGACCTATGGCTCATCTGGAGATG
TGCAGCTGCCTGTGGTGCGGTACAATCCTCAAGACTATGCTGCACTACCAGCCAGTTCCAGCCACCCGACCGTCCGGAATAGACCTAGATATAAGGATCT
CCGCTATGATGGCAAGTGCAACTTGAAAGCCTTCCTTCATAAATTTGTTCGCCAACAGTGGAATGAGACCGAGCAACATGATCAATTCTGTTTCTTTCTG
GAGGGCCCGGCCATTGAGTATTACACTTTGATGCTGGAGACTACCCCGCCTGAGGTTCAGCGAAATACTCAGGAAGTTTGACAAGCGCTTTGGCTCATCA
==> Mitochodrion2.fasta <==
>utg2733 length=28457 nodes=17
TCACCCTGCCCCAACTCCGTTTTCTACAATGTTAGACATAAGCATAAGATAAAGAGACCCTGGCAAAACTCAAAATCTAAATGCATTAATCGAGGGAAAT
TGCATGTCTGCTACTAGAAGCATCAAAGGGATAAGCCAGTTACCAAACCCCCCAATTATTACAGGTATAACAAAGAAAAAAATCATAACCAACGCATGCC
TAGTTACAACTGCATTATAAGTCACGGGGTCTAAAACTTAGCTCCAGGGTTATAAAGTCTCCAACGAAATAAGAGACCTAAACCTAGTTCCCGCAAGAAC
AGCTCAAAATCCAAATACTATATAAAACCTTCCAATGTCTAAATGATTGTTGACATAAATGTCCCCCGCTTTTCAAAAAGAAGAACTGGACAAGGGAAAA
ACACTTTTAAGGAGCGAACCTTTTAAAAAACTTTAATTCCTGGTGAATCATTATTCTTAGACCAACCCAATTATGAGTAGTTTCAAATTTGAAGTTTGAC
AGTTTAATCCTTAACTTATGGTCCAAAGCACTCTGAGAGTACAAAGAGTACACTCCAGAGTCAGATTACGTAAGATACCTACTATCAAACTAAGCCCCAA
AGATGTTTCACACGCGACTAAAACAAGAAAAACGAATAGCCTATGACTGCTATCCATCCCTGACAGCAAATTAGTATACCACCTAGACTGACACATACGC
CCTCTATTAAAATAAGGTATCTAAGGAAGTTAGAAACTTCTTAAGTATTGCCCCAATAACCACCCAAAAAACCATAGTAAATAAAGCTATTGACCTCTTT
GTCATTTTAAATTTTATAATAAAAAAAAATACACAGTAATTCCTAAAACAAACGGCAGCAGTGTCTTTCAAGCTGCTATCATCAATTGATCATATCGAAA
Job name: issVq_20171107162307
Your job has failed. Please try again.
If the problem persists, please contact the support.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/70Replace spaces and special chars in job names2017-11-08T17:58:27+01:00Floreal CabanettesReplace spaces and special chars in job names1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/71Split of contigs: when to do that?2017-12-05T15:02:08+01:00Floreal CabanettesSplit of contigs: when to do that?On big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automaticallyOn big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automatically1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/72If more than 75% of contigs have length < 1% of the full fasta, do the sort a...2018-01-29T18:17:18+01:00Floreal CabanettesIf more than 75% of contigs have length < 1% of the full fasta, do the sort automaticallyChange borns if necessary!Change borns if necessary!1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/73Timeout if sort is too long2017-11-14T17:23:18+01:00Floreal CabanettesTimeout if sort is too longAs sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc.....As sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc...)
- Make it asynchronous:
- By a websocket connection. If chosen, could also be used for the status page
- By a regular server call by the client (it's not the best choice... :-( )
- Make the sort on job launch and save it. Just load it on click on the sort button. Solves the problem, but job takes more time (juste few seconds in general...) and the server could do it while the user will never want the sorted version.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/74Menu Download / Install on genotoul hosted version2018-02-23T16:19:36+01:00Floreal CabanettesMenu Download / Install on genotoul hosted versionMaybe for all version... To be discussed!Maybe for all version... To be discussed!1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/75Export pictures with current zoom applied2018-04-11T17:48:51+02:00Floreal CabanettesExport pictures with current zoom appliedUntil now, we export the picture by rest scale. Do it without that. Needs to be re-draw, do not use the scale.Until now, we export the picture by rest scale. Do it without that. Needs to be re-draw, do not use the scale.1.1Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/76Change restore zoom color2017-11-17T15:24:50+01:00Floreal CabanettesChange restore zoom colorLe vert fluo c'est trèèèès moyen !!!Le vert fluo c'est trèèèès moyen !!!1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/77Revoir le système de notifications2017-11-13T15:00:25+01:00Floreal CabanettesRevoir le système de notificationsCar noty.js a ses limites...
Le placement idéal des notifications serait en top center, sauf que ça marche mal en noty.js... Voir les concurrents.Car noty.js a ses limites...
Le placement idéal des notifications serait en top center, sauf que ça marche mal en noty.js... Voir les concurrents.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/78input file names in the mail2017-11-17T17:23:10+01:00Christophe Kloppinput file names in the mailCould you add the input file names in the mail send to the user?
The submission date and time should also be added Could you add the input file names in the mail send to the user?
The submission date and time should also be added 1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/79Mettre le target avant le query dans le formulaire2017-11-17T10:10:39+01:00Floreal CabanettesMettre le target avant le query dans le formulaire1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/81Disable sort on all-vs-all mode2017-11-17T11:10:06+01:00Floreal CabanettesDisable sort on all-vs-all mode1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/83Scheduler local pour les soumissions de jobs locaux2017-11-21T18:34:12+01:00Floreal CabanettesScheduler local pour les soumissions de jobs locaux1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/84Cron pour vérifier les jobs locaux2017-11-21T18:34:12+01:00Floreal CabanettesCron pour vérifier les jobs locauxSi un job est started, le cron vérifie que le processus est toujours actif. Sinon il passe le job en erreur.
Se fera en même temps que le scheduler qui lancera les jobsSi un job est started, le cron vérifie que le processus est toujours actif. Sinon il passe le job en erreur.
Se fera en même temps que le scheduler qui lancera les jobs1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/85Export association table : add info of reverse2017-11-20T17:44:33+01:00Floreal CabanettesExport association table : add info of reverse+ if not reverse, - else+ if not reverse, - else1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/86Reverse contigs: do a reverse complement, not just reverse the sequence2017-11-21T10:15:25+01:00Floreal CabanettesReverse contigs: do a reverse complement, not just reverse the sequence1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/87Create a galery on the website to present results with...2018-01-30T18:25:34+01:00Christophe KloppCreate a galery on the website to present results with...execution times in order for the users to see the results without having to process them.execution times in order for the users to see the results without having to process them.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/88Si on met le même id plus de 2 fois dans la soumission d'un job, ça plante (o...2017-12-05T17:25:12+01:00Floreal CabanettesSi on met le même id plus de 2 fois dans la soumission d'un job, ça plante (on passe pas à _3)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/89Add cluster submission support2017-12-13T14:10:48+01:00Floreal CabanettesAdd cluster submission support1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/90Add support to local+cluster batch system type2017-12-15T16:10:53+01:00Floreal CabanettesAdd support to local+cluster batch system typeLaunch small jobs locally and big jobs on clusterLaunch small jobs locally and big jobs on cluster1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/91Change ORM2017-12-13T16:55:46+01:00Floreal CabanettesChange ORMPony ORM has some problems until the beginning. With new implementations it is really a problem. Try to found another ORM...Pony ORM has some problems until the beginning. With new implementations it is really a problem. Try to found another ORM...1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/94Add check on file upload size server side2018-01-04T13:05:59+01:00Floreal CabanettesAdd check on file upload size server side1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/95Catch malformed errors server side and client side2018-01-04T13:31:38+01:00Floreal CabanettesCatch malformed errors server side and client sideFor example, must start with http(s)?:// or ftp://
Server side, catch the exceptionFor example, must start with http(s)?:// or ftp://
Server side, catch the exception1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/96Prepare big jobs on cluster2018-01-05T16:26:38+01:00Floreal CabanettesPrepare big jobs on clusterBecause prepare step can be huge...Because prepare step can be huge...1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/98Proposer plusieurs palettes de couleur2018-01-29T17:17:28+01:00Floreal CabanettesProposer plusieurs palettes de couleur- Normal (actuelle)
- Daltonien+
- Noir & Blanc- Normal (actuelle)
- Daltonien+
- Noir & Blanc1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/99List of query-target associations table: add coordinates2018-02-06T15:21:28+01:00Floreal CabanettesList of query-target associations table: add coordinates1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/100Permettre le téléchargement d'une page web permettant de visualiser en intera...2018-07-13T17:21:28+02:00Floreal CabanettesPermettre le téléchargement d'une page web permettant de visualiser en interactif en local1.2Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/102match coverage bar of the reference genome2018-07-12T14:37:03+02:00Christophe Kloppmatch coverage bar of the reference genomeThis feature is present in r2cat : A horizontal bar at the bottom helps to assess the coverage of the matches: maximum coverage is displayed in black and fades to light grey with less coverage. Uncovered regions are marked explicitly.
ht...This feature is present in r2cat : A horizontal bar at the bottom helps to assess the coverage of the matches: maximum coverage is displayed in black and fades to light grey with less coverage. Uncovered regions are marked explicitly.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2820676/1.2Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/103Remove BDD2018-01-23T10:26:58+01:00Floreal CabanettesRemove BDDTest with 240 concurrent jobs splitted in 4 groups (4 users). 8 jobs failed because of two much opened connections.
For jobs, we can replace BDD by a file in each job folder.
For sessions, may be we can replace BDD by a storage in memo...Test with 240 concurrent jobs splitted in 4 groups (4 users). 8 jobs failed because of two much opened connections.
For jobs, we can replace BDD by a file in each job folder.
For sessions, may be we can replace BDD by a storage in memory...1.0Floreal CabanettesFloreal Cabanettes2018-01-19https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/104Sort: still store sorted version on unsort2018-01-29T15:31:00+01:00Floreal CabanettesSort: still store sorted version on unsortJust set if current vision is sorted or not (.sorted file)Just set if current vision is sorted or not (.sorted file)1.0Floreal CabanettesFloreal Cabanettes2018-01-19https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/105Improve databases2018-01-18T11:04:46+01:00Floreal CabanettesImprove databasesFor Job and Session:
- new is a classe method that create the new object from informations given (as now, but as class method) and returns it. It's called without instance a new object.
- So when we instance a new object, the Job/Sessi...For Job and Session:
- new is a classe method that create the new object from informations given (as now, but as class method) and returns it. It's called without instance a new object.
- So when we instance a new object, the Job/Session already exists. So we execute the load method in the __init__, and load method becomes private (_load)
- So we remove the load calling from other methods, not needed anymore1.0Floreal CabanettesFloreal Cabanettes2018-01-18https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/106Fix big data in all-vs-all mode2018-02-05T17:09:07+01:00Floreal CabanettesFix big data in all-vs-all modeIn all-vs-all mode (only target is given), no split is done. Probably for that reason, we need too much memory and time...
Solutions:
- Limit all-vs-all mode to small or medium analysis (done in 1/2 h)
- Split target (so target and quer...In all-vs-all mode (only target is given), no split is done. Probably for that reason, we need too much memory and time...
Solutions:
- Limit all-vs-all mode to small or medium analysis (done in 1/2 h)
- Split target (so target and query [the same as the target] will be splitted... We must change the code to take that in account: needs more work (1/2 day)1.0Floreal CabanettesFloreal Cabanettes2018-02-02https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/107Clean session status links and job status links on clear sessions/jobs and pe...2018-01-23T10:24:20+01:00Floreal CabanettesClean session status links and job status links on clear sessions/jobs and periodicallySome fails may keep bad links...Some fails may keep bad links...1.0Floreal CabanettesFloreal Cabanettes2018-01-22https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/108Error: MySQL server has gone away2018-01-29T11:58:46+01:00Floreal CabanettesError: MySQL server has gone awayHappens after 1 day. We must restart mysql and apache to restore the website.Happens after 1 day. We must restart mysql and apache to restore the website.1.0Floreal CabanettesFloreal Cabanettes2018-01-26https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/109Run a job: if we choose a file, and then we switch to URL, the size of the fi...2018-01-29T10:50:50+01:00Floreal CabanettesRun a job: if we choose a file, and then we switch to URL, the size of the file don't disappearMake it hiddenMake it hidden1.0Floreal CabanettesFloreal Cabanettes2018-01-25https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/110Download of query: remove contigs not present in the index2018-01-29T16:06:39+01:00Floreal CabanettesDownload of query: remove contigs not present in the indexBecause they has been filtered outBecause they has been filtered out1.0Floreal CabanettesFloreal Cabanettes2018-02-02https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/111Summary: fail for big data: timeout2018-01-31T15:12:42+01:00Floreal CabanettesSummary: fail for big data: timeout1.0Floreal CabanettesFloreal Cabanettes2018-02-02https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/112Add a table beside the gallery items with times and memory usage for all items2018-02-05T16:21:19+01:00Floreal CabanettesAdd a table beside the gallery items with times and memory usage for all items1.0Floreal CabanettesFloreal Cabanettes2018-02-02https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/113Summary stats failed on big data2018-02-02T16:23:06+01:00Floreal CabanettesSummary stats failed on big dataHuman VS Chimp for example.
Too much memory is used, it make the server unresponding...
Fixes propals:
- Change the algorithm to use less memory
- Make summary on job run, save it and just show it on button clickHuman VS Chimp for example.
Too much memory is used, it make the server unresponding...
Fixes propals:
- Change the algorithm to use less memory
- Make summary on job run, save it and just show it on button click1.0Floreal CabanettesFloreal Cabanettes2018-02-09https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/114Standalone version2018-02-08T17:44:09+01:00Floreal CabanettesStandalone versionTo launch D-Genies on a local computer, with only 1 user.To launch D-Genies on a local computer, with only 1 user.1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/115Windows compatibility2018-02-22T10:55:48+01:00Floreal CabanettesWindows compatibilityCheck program is compatible for windows in standalone mode, and make required changes to make it compatible.Check program is compatible for windows in standalone mode, and make required changes to make it compatible.1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/116Remove "you will receive a mail...." on standalone version2018-02-15T14:12:14+01:00Floreal CabanettesRemove "you will receive a mail...." on standalone version1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/117Standalone version: problem with treatments which requires mail2018-02-16T14:08:51+01:00Floreal CabanettesStandalone version: problem with treatments which requires mailTwo possibilities:
- disable them on standalone version
- change code to be compatible withTwo possibilities:
- disable them on standalone version
- change code to be compatible with1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/118Sometimes (on windows at least) flask is really long to start. Check flask is...2018-02-15T14:12:14+01:00Floreal CabanettesSometimes (on windows at least) flask is really long to start. Check flask is already started before launch the browser1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/119In standalone mode, load all jobs on startup to add them in the result menu2018-02-16T18:51:10+01:00Floreal CabanettesIn standalone mode, load all jobs on startup to add them in the result menu1.0Floreal CabanettesFloreal Cabanettes2018-02-20https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/120Add a button to delete a job2018-02-16T18:03:13+01:00Floreal CabanettesAdd a button to delete a jobAdd protected jobs (for webserver mode) which cannot be deleted by this button. Or all gallery jobs are protected.Add protected jobs (for webserver mode) which cannot be deleted by this button. Or all gallery jobs are protected.1.0Floreal CabanettesFloreal Cabanettes2018-02-20https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/121Check XSS and other security breaches2018-02-19T14:48:41+01:00Floreal CabanettesCheck XSS and other security breaches1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/123Ease integration of a new tool2018-04-03T13:11:55+02:00Floreal CabanettesEase integration of a new tool1.1Floreal CabanettesFloreal Cabanettes2018-04-06https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/124Add mashmap tool2018-07-12T14:36:31+02:00Floreal CabanettesAdd mashmap toolhttps://github.com/marbl/MashMaphttps://github.com/marbl/MashMap1.2Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/125Add analytics logs2018-04-03T13:09:17+02:00Floreal CabanettesAdd analytics logsAdd logs which will save size of query/target for each runAdd logs which will save size of query/target for each run1.1Floreal CabanettesFloreal Cabanettes2018-03-15https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/126Add alignment file as input instead of query and target2018-04-09T09:48:42+02:00Floreal CabanettesAdd alignment file as input instead of query and targetSupports PAF and MAF (Multiple Alignment File) formatsSupports PAF and MAF (Multiple Alignment File) formats1.1Floreal CabanettesFloreal Cabanettes2018-04-06https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/127Add color palettes2018-04-09T10:02:21+02:00Floreal CabanettesAdd color palettes- a palette with low identity matches more visible than high identity matches (inverted)
- a plaette with all with the same color (all black)- a palette with low identity matches more visible than high identity matches (inverted)
- a plaette with all with the same color (all black)1.1Floreal CabanettesFloreal Cabanettes2018-04-09https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/128Add export and import as Tar file2018-04-10T11:21:13+02:00Floreal CabanettesAdd export and import as Tar fileExport indexes + paf file as a tar. Add an option to import it to show again the plot.Export indexes + paf file as a tar. Add an option to import it to show again the plot.1.1Floreal CabanettesFloreal Cabanettes2018-04-11https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/129Check if align file from URL is working2018-04-11T17:39:04+02:00Floreal CabanettesCheck if align file from URL is working1.1Floreal CabanettesFloreal Cabanettes2018-04-10https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/130Check index files are correct, like other files2018-04-11T18:23:57+02:00Floreal CabanettesCheck index files are correct, like other files1.1Floreal CabanettesFloreal Cabanettes2018-04-12https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/131Update doc for 1.1 version2018-04-12T17:33:06+02:00Floreal CabanettesUpdate doc for 1.1 version- New run form
- Export backup in menu
- Export SVG/PNG keep the zoom- New run form
- Export backup in menu
- Export SVG/PNG keep the zoom1.1Floreal CabanettesFloreal Cabanettes