D-GENIES issueshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues2017-11-10T17:21:24+01:00https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/7Ajout de l'export2017-11-10T17:21:24+01:00Floreal CabanettesAjout de l'exportAjouter l'export au format :
* svg
* png
* PAF file
Pour SVG et PNG : soit toute l'image soit seulement l'image affichée. Pareil pour PAF ?Ajouter l'export au format :
* svg
* png
* PAF file
Pour SVG et PNG : soit toute l'image soit seulement l'image affichée. Pareil pour PAF ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/32Test Homme VS Singe => passe en mémoire ?2017-11-09T17:35:00+01:00Floreal CabanettesTest Homme VS Singe => passe en mémoire ?Si non, quelles sont les ressources nécessaires ?Si non, quelles sont les ressources nécessaires ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/70Replace spaces and special chars in job names2017-11-08T17:58:27+01:00Floreal CabanettesReplace spaces and special chars in job names1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/47Test on very small sequences2017-11-08T17:50:51+01:00Christophe KloppTest on very small sequencestest on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTAC...test on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTACAGGTTATGCGGTCCCAACGCTTGAGGCCTCC
TCCCAGCCTTACAGTCCTGAGGGAGAGGGAAGTAGAATAGCACAAGTCCAGCCACAGTATCATGAGCCCTTGTCTGGGGAACCCCATCTCCTGGGTGACC
ATTCATACATCCAGTACCTCATGCATATGAGCCCCCACTAGAGATGTACCTTCTAATGCAAGTCACGCGCGGAATCCCGCTGCGTCTTGCAGTCCCCTGA
ATATGCACGGATATCCGCAGCGTCTCATCATACCCATGAAGATGCGCGGTTATCCGCAGCGCCTCATCATCCCCATGAACATGTGCGGTTATCCGCAGCG
CCTCATCATCCCCATGAGCACGCGCGGTTATCCGCAGCATCTCGCCATGCCCCGGAGTTTTCGCAGACGCCCATTGCGACCTATGGCTCATCTGGAGATG
TGCAGCTGCCTGTGGTGCGGTACAATCCTCAAGACTATGCTGCACTACCAGCCAGTTCCAGCCACCCGACCGTCCGGAATAGACCTAGATATAAGGATCT
CCGCTATGATGGCAAGTGCAACTTGAAAGCCTTCCTTCATAAATTTGTTCGCCAACAGTGGAATGAGACCGAGCAACATGATCAATTCTGTTTCTTTCTG
GAGGGCCCGGCCATTGAGTATTACACTTTGATGCTGGAGACTACCCCGCCTGAGGTTCAGCGAAATACTCAGGAAGTTTGACAAGCGCTTTGGCTCATCA
==> Mitochodrion2.fasta <==
>utg2733 length=28457 nodes=17
TCACCCTGCCCCAACTCCGTTTTCTACAATGTTAGACATAAGCATAAGATAAAGAGACCCTGGCAAAACTCAAAATCTAAATGCATTAATCGAGGGAAAT
TGCATGTCTGCTACTAGAAGCATCAAAGGGATAAGCCAGTTACCAAACCCCCCAATTATTACAGGTATAACAAAGAAAAAAATCATAACCAACGCATGCC
TAGTTACAACTGCATTATAAGTCACGGGGTCTAAAACTTAGCTCCAGGGTTATAAAGTCTCCAACGAAATAAGAGACCTAAACCTAGTTCCCGCAAGAAC
AGCTCAAAATCCAAATACTATATAAAACCTTCCAATGTCTAAATGATTGTTGACATAAATGTCCCCCGCTTTTCAAAAAGAAGAACTGGACAAGGGAAAA
ACACTTTTAAGGAGCGAACCTTTTAAAAAACTTTAATTCCTGGTGAATCATTATTCTTAGACCAACCCAATTATGAGTAGTTTCAAATTTGAAGTTTGAC
AGTTTAATCCTTAACTTATGGTCCAAAGCACTCTGAGAGTACAAAGAGTACACTCCAGAGTCAGATTACGTAAGATACCTACTATCAAACTAAGCCCCAA
AGATGTTTCACACGCGACTAAAACAAGAAAAACGAATAGCCTATGACTGCTATCCATCCCTGACAGCAAATTAGTATACCACCTAGACTGACACATACGC
CCTCTATTAAAATAAGGTATCTAAGGAAGTTAGAAACTTCTTAAGTATTGCCCCAATAACCACCCAAAAAACCATAGTAAATAAAGCTATTGACCTCTTT
GTCATTTTAAATTTTATAATAAAAAAAAATACACAGTAATTCCTAAAACAAACGGCAGCAGTGTCTTTCAAGCTGCTATCATCAATTGATCATATCGAAA
Job name: issVq_20171107162307
Your job has failed. Please try again.
If the problem persists, please contact the support.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/38Add global exception handler to catch all exception and pass job on error eve...2017-11-08T17:46:31+01:00Floreal CabanettesAdd global exception handler to catch all exception and pass job on error every time1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/29Send mail on job success/fail2017-11-07T17:20:06+01:00Floreal CabanettesSend mail on job success/failHistoire que le gars il entre pas son mail pour rien... :-)Histoire que le gars il entre pas son mail pour rien... :-)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/42Check extensions of files before upload (for local files)2017-11-06T11:11:56+01:00Floreal CabanettesCheck extensions of files before upload (for local files)Couldn't be done for URLs as we not always know name of files from URLCouldn't be done for URLs as we not always know name of files from URL1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/28Gérer les erreurs d'upload2017-11-03T18:23:43+01:00Floreal CabanettesGérer les erreurs d'uploadEn cas d'erreur tout plante et c'est le drame :(En cas d'erreur tout plante et c'est le drame :(1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/27Fix bug on small screens for run page2017-11-03T18:06:46+01:00Floreal CabanettesFix bug on small screens for run pageUse a table (responsive with bootstrap) instead of bootstrap divs #beurkUse a table (responsive with bootstrap) instead of bootstrap divs #beurk1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/39Do the index after the map, if this one has not failed2017-11-03T16:09:28+01:00Floreal CabanettesDo the index after the map, if this one has not failed1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/41If we have too small blocks on contigs or target, too much memory used becaus...2017-11-03T16:01:46+01:00Floreal CabanettesIf we have too small blocks on contigs or target, too much memory used because of too much break linesNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionnerNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionner1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/37Check of uploaded extension not done (or does not cause any error)2017-11-03T11:05:12+01:00Floreal CabanettesCheck of uploaded extension not done (or does not cause any error)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/31Identité : faire en absolu2017-11-02T17:51:43+01:00Floreal CabanettesIdentité : faire en absoluLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondanceLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondance1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/30Applications.properties & Wsgi file: change url to be valid in distributed pa...2017-11-02T17:10:29+01:00Floreal CabanettesApplications.properties & Wsgi file: change url to be valid in distributed package1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/11Set files from URL instead of upload them2017-11-01T20:45:12+01:00Floreal CabanettesSet files from URL instead of upload themUse an URL in the form instead of download fileUse an URL in the form instead of download file1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/23Ajax uploading2017-11-01T20:45:12+01:00Floreal CabanettesAjax uploadingUse ajax to upload files and show progress bar of uploads (Use of JQuery file puload)Use ajax to upload files and show progress bar of uploads (Use of JQuery file puload)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/17Implement support of compressed fasta files (*.gz)2017-10-30T17:38:02+01:00Floreal CabanettesImplement support of compressed fasta files (*.gz)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/16Add a tooltip to show current contig and target on cursor position2017-10-27T15:21:44+02:00Floreal CabanettesAdd a tooltip to show current contig and target on cursor position1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/3Ajouter la possibilité de sélectionner la zone à afficher à partir de 2 listes2017-10-27T10:57:04+02:00Floreal CabanettesAjouter la possibilité de sélectionner la zone à afficher à partir de 2 listesLes 2 listes sont ajoutées dans le bandeau à droite (ou peut être placé en bas éventuellement)Les 2 listes sont ajoutées dans le bandeau à droite (ou peut être placé en bas éventuellement)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/1Permettre l'input d'un seul fasta et faire de l'auto-alignement2017-10-26T18:14:16+02:00Floreal CabanettesPermettre l'input d'un seul fasta et faire de l'auto-alignementUtiliser l'option minimap :
-X skip self and dual mappings (for the all-vs-all mode)Utiliser l'option minimap :
-X skip self and dual mappings (for the all-vs-all mode)1.0Floreal CabanettesFloreal Cabanettes