D-GENIES issueshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues2017-11-13T15:00:25+01:00https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/77Revoir le système de notifications2017-11-13T15:00:25+01:00Floreal CabanettesRevoir le système de notificationsCar noty.js a ses limites...
Le placement idéal des notifications serait en top center, sauf que ça marche mal en noty.js... Voir les concurrents.Car noty.js a ses limites...
Le placement idéal des notifications serait en top center, sauf que ça marche mal en noty.js... Voir les concurrents.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/76Change restore zoom color2017-11-17T15:24:50+01:00Floreal CabanettesChange restore zoom colorLe vert fluo c'est trèèèès moyen !!!Le vert fluo c'est trèèèès moyen !!!1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/75Export pictures with current zoom applied2018-04-11T17:48:51+02:00Floreal CabanettesExport pictures with current zoom appliedUntil now, we export the picture by rest scale. Do it without that. Needs to be re-draw, do not use the scale.Until now, we export the picture by rest scale. Do it without that. Needs to be re-draw, do not use the scale.1.1Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/74Menu Download / Install on genotoul hosted version2018-02-23T16:19:36+01:00Floreal CabanettesMenu Download / Install on genotoul hosted versionMaybe for all version... To be discussed!Maybe for all version... To be discussed!1.0Floreal CabanettesFloreal Cabanettes2018-02-23https://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/73Timeout if sort is too long2017-11-14T17:23:18+01:00Floreal CabanettesTimeout if sort is too longAs sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc.....As sort is done server-side, if it's too long we have a timeout (because we are not asynchronous).
Solutions:
- Limit number of lines taken in account for the sort (not sure it solves the problem, may be a problem for export fasta etc...)
- Make it asynchronous:
- By a websocket connection. If chosen, could also be used for the status page
- By a regular server call by the client (it's not the best choice... :-( )
- Make the sort on job launch and save it. Just load it on click on the sort button. Solves the problem, but job takes more time (juste few seconds in general...) and the server could do it while the user will never want the sorted version.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/72If more than 75% of contigs have length < 1% of the full fasta, do the sort a...2018-01-29T18:17:18+01:00Floreal CabanettesIf more than 75% of contigs have length < 1% of the full fasta, do the sort automaticallyChange borns if necessary!Change borns if necessary!1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/71Split of contigs: when to do that?2017-12-05T15:02:08+01:00Floreal CabanettesSplit of contigs: when to do that?On big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automaticallyOn big genomes, we improve RAM and speed by cutting the contigs in parts of 10MO. Determine when to do that and do it automatically1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/70Replace spaces and special chars in job names2017-11-08T17:58:27+01:00Floreal CabanettesReplace spaces and special chars in job names1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/47Test on very small sequences2017-11-08T17:50:51+01:00Christophe KloppTest on very small sequencestest on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTAC...test on
==> Mitochodrion1.fasta <==
>utg74 length=26934 nodes=20
GTCCAGGAGTCCTTGGTCCATACCTCACAGGGATACTTTGGTCTGCGCATGTGCACTGCTGTAACCCAGCCGGTCGCACCCAGCTGTTATTACCCAACAC
CTCAGCCCGGGATGATCAGTATGTTACTGTGCAGGGGGGGACAATGTTGGGACTGCACCAGTATTTTACAGGTTATGCGGTCCCAACGCTTGAGGCCTCC
TCCCAGCCTTACAGTCCTGAGGGAGAGGGAAGTAGAATAGCACAAGTCCAGCCACAGTATCATGAGCCCTTGTCTGGGGAACCCCATCTCCTGGGTGACC
ATTCATACATCCAGTACCTCATGCATATGAGCCCCCACTAGAGATGTACCTTCTAATGCAAGTCACGCGCGGAATCCCGCTGCGTCTTGCAGTCCCCTGA
ATATGCACGGATATCCGCAGCGTCTCATCATACCCATGAAGATGCGCGGTTATCCGCAGCGCCTCATCATCCCCATGAACATGTGCGGTTATCCGCAGCG
CCTCATCATCCCCATGAGCACGCGCGGTTATCCGCAGCATCTCGCCATGCCCCGGAGTTTTCGCAGACGCCCATTGCGACCTATGGCTCATCTGGAGATG
TGCAGCTGCCTGTGGTGCGGTACAATCCTCAAGACTATGCTGCACTACCAGCCAGTTCCAGCCACCCGACCGTCCGGAATAGACCTAGATATAAGGATCT
CCGCTATGATGGCAAGTGCAACTTGAAAGCCTTCCTTCATAAATTTGTTCGCCAACAGTGGAATGAGACCGAGCAACATGATCAATTCTGTTTCTTTCTG
GAGGGCCCGGCCATTGAGTATTACACTTTGATGCTGGAGACTACCCCGCCTGAGGTTCAGCGAAATACTCAGGAAGTTTGACAAGCGCTTTGGCTCATCA
==> Mitochodrion2.fasta <==
>utg2733 length=28457 nodes=17
TCACCCTGCCCCAACTCCGTTTTCTACAATGTTAGACATAAGCATAAGATAAAGAGACCCTGGCAAAACTCAAAATCTAAATGCATTAATCGAGGGAAAT
TGCATGTCTGCTACTAGAAGCATCAAAGGGATAAGCCAGTTACCAAACCCCCCAATTATTACAGGTATAACAAAGAAAAAAATCATAACCAACGCATGCC
TAGTTACAACTGCATTATAAGTCACGGGGTCTAAAACTTAGCTCCAGGGTTATAAAGTCTCCAACGAAATAAGAGACCTAAACCTAGTTCCCGCAAGAAC
AGCTCAAAATCCAAATACTATATAAAACCTTCCAATGTCTAAATGATTGTTGACATAAATGTCCCCCGCTTTTCAAAAAGAAGAACTGGACAAGGGAAAA
ACACTTTTAAGGAGCGAACCTTTTAAAAAACTTTAATTCCTGGTGAATCATTATTCTTAGACCAACCCAATTATGAGTAGTTTCAAATTTGAAGTTTGAC
AGTTTAATCCTTAACTTATGGTCCAAAGCACTCTGAGAGTACAAAGAGTACACTCCAGAGTCAGATTACGTAAGATACCTACTATCAAACTAAGCCCCAA
AGATGTTTCACACGCGACTAAAACAAGAAAAACGAATAGCCTATGACTGCTATCCATCCCTGACAGCAAATTAGTATACCACCTAGACTGACACATACGC
CCTCTATTAAAATAAGGTATCTAAGGAAGTTAGAAACTTCTTAAGTATTGCCCCAATAACCACCCAAAAAACCATAGTAAATAAAGCTATTGACCTCTTT
GTCATTTTAAATTTTATAATAAAAAAAAATACACAGTAATTCCTAAAACAAACGGCAGCAGTGTCTTTCAAGCTGCTATCATCAATTGATCATATCGAAA
Job name: issVq_20171107162307
Your job has failed. Please try again.
If the problem persists, please contact the support.1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/41If we have too small blocks on contigs or target, too much memory used becaus...2017-11-03T16:01:46+01:00Floreal CabanettesIf we have too small blocks on contigs or target, too much memory used because of too much break linesNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionnerNe pas afficher les lignes de séparation si le bloc est trop petit. On peut afficher un cadre gris sur le côté pour le mentionner1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/39Do the index after the map, if this one has not failed2017-11-03T16:09:28+01:00Floreal CabanettesDo the index after the map, if this one has not failed1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/34Stockage des données sous forme compressée2018-02-07T10:34:13+01:00Floreal CabanettesStockage des données sous forme compressée=> Il faut inciter les utilisateurs a utiliser un format compressé=> Il faut inciter les utilisateurs a utiliser un format compressé1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/32Test Homme VS Singe => passe en mémoire ?2017-11-09T17:35:00+01:00Floreal CabanettesTest Homme VS Singe => passe en mémoire ?Si non, quelles sont les ressources nécessaires ?Si non, quelles sont les ressources nécessaires ?1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/31Identité : faire en absolu2017-11-02T17:51:43+01:00Floreal CabanettesIdentité : faire en absoluLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondanceLes limites deviennent :
- 0
- 0.25
- 0.5
- 0.75
- 1
Corriger les couleurs en correspondance1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/38Add global exception handler to catch all exception and pass job on error eve...2017-11-08T17:46:31+01:00Floreal CabanettesAdd global exception handler to catch all exception and pass job on error every time1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/33Distribution du programme2018-02-22T10:56:13+01:00Floreal CabanettesDistribution du programmeMettre à disposition l'outil :
- Via PIP
- Via AnacondaMettre à disposition l'outil :
- Via PIP
- Via Anaconda1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/44Vérifier que les fichiers fasta fournis sont valides2017-12-05T17:15:49+01:00Floreal CabanettesVérifier que les fichiers fasta fournis sont valides=> Fichiers non vides
=> Format fasta correct=> Fichiers non vides
=> Format fasta correct1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/43Handle memory exception from minimap2017-11-17T17:22:28+01:00Floreal CabanettesHandle memory exception from minimapAs minimap says there is a lack of memory, report it to the user (not directly it, say to it its data are too big...)As minimap says there is a lack of memory, report it to the user (not directly it, say to it its data are too big...)1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/9Big genomes: filter to keep acceptable in memory2017-11-20T16:34:08+01:00Floreal CabanettesBig genomes: filter to keep acceptable in memoryPistes :
- Éliminer les plus petits matchs
- Définir un nombre de matchs maximal à afficher
- Filtre côté client ou serveur ? Je dirais serveur quand c'est vraiment très gros, sinon clientPistes :
- Éliminer les plus petits matchs
- Définir un nombre de matchs maximal à afficher
- Filtre côté client ou serveur ? Je dirais serveur quand c'est vraiment très gros, sinon client1.0Floreal CabanettesFloreal Cabanetteshttps://forgemia.inra.fr/genotoul-bioinfo/dgenies/-/issues/37Check of uploaded extension not done (or does not cause any error)2017-11-03T11:05:12+01:00Floreal CabanettesCheck of uploaded extension not done (or does not cause any error)1.0Floreal CabanettesFloreal Cabanettes