Commit 8e0f785c authored by fsoubes's avatar fsoubes

update

parent 5449a233

Too many changes to show.

To preserve performance only 386 of 386+ files are displayed.

^packrat/
^\.Rprofile$
#### -- Packrat Autoloader (version 0.4.9-3) -- ####
source("packrat/init.R")
#### -- End Packrat Autoloader -- ####
# History files
.Rhistory
.Rapp.history
# Session Data files
.RData
# Example code in package build process
*-Ex.R
# Output files from R CMD build
/*.tar.gz
# Output files from R CMD check
/*.Rcheck/
Coursera-Developing-Data-Products
# RStudio files
.Rproj.user/
# produced vignettes
vignettes/*.html
vignettes/*.pdf
# OAuth2 token, see https://github.com/hadley/httr/releases/tag/v0.3
.httr-oauth
# knitr and R markdown default cache directories
/*_cache/
/cache/
# Temporary files created by R markdown
*.utf8.md
*.knit.md
# Shiny token, see https://shiny.rstudio.com/articles/shinyapps.html
rsconnect/
# pas de fichier temporaire
*~
#pas de fichier log
*.log
#pas de fichier temp
.temp
.tmp
#pas de fichier xlsx
.xlsx
#pas de Rplots.pdf
Rplots.pdf
.Rproj.user
packrat/lib*/
#shiny test ignore and expect packrat
packrat/src/*
!packrat/src/BiocGenerics
!packrat/src/Biobase
!packrat/src/IRanges
!packrat/src/S4Vectors
!packrat/src/AnnotationDbi
!packrat/src/annotate
!packrat/src/GSEABase
!packrat/src/genefilter
!packrat/src/graph
!packrat/src/RBGL
!packrat/src/AnnotationForge
!packrat/src/Category
!packrat/src/GO.db
!packrat/src/Rgraphviz
!packrat/src/org.Mm.eg.db
!packrat/src/RDAVIDWebService
!packrat/src/GOstats
!packrat/src/org.Gg.eg.db
!packrat/src/org.Dr.eg.db
!packrat/src/org.Hs.eg.db
!packrat/src/org.Rn.eg.db
!packrat/src/org.Ss.eg.db
etc
google-analytics.js
www/google-analytics.html
dist: trusty # Use Ubuntu 14.04 image (instead of 12.04)
language: r
r: 3.5.0
r: bioc-release
sudo: false
bioc_required: true
warnings_are_errors: false
addons:
apt:
packages:
- libv8-3.14-dev
# Install packrat if needed and have it restore packages.
install:
- R -e 'if (system.file(package="packrat") == "") install.packages("packrat")'
- Rscript -e 'source(file = "http://bioconductor.org/biocLite.R");tryCatch(useDevel(devel = TRUE), error = function(err){message(err)})'
- R -e "0" --args --bootstrap-packrat
- R -e "packrat::packify(); packrat::restore()"
cache:
# Main R library
packages: true
directories:
# Packrat packages
- packrat/lib
# PhantomJS
- travis_phantomjs
# Install PhantomJS (if not cached)
before_install:
- "export PHANTOMJS_VERSION=2.1.1"
- "phantomjs --version"
- "export PATH=$PWD/travis_phantomjs/phantomjs-$PHANTOMJS_VERSION-linux-x86_64/bin:$PATH"
- "hash -r"
- "phantomjs --version"
- "if [ $(phantomjs --version) != $PHANTOMJS_VERSION ]; then rm -rf $PWD/travis_phantomjs; mkdir -p $PWD/travis_phantomjs; fi"
- "if [ $(phantomjs --version) != $PHANTOMJS_VERSION ]; then wget https://github.com/Medium/phantomjs/releases/download/v$PHANTOMJS_VERSION/phantomjs-$PHANTOMJS_VERSION-linux-x86_64.tar.bz2 -O $PWD/travis_phantomjs/phantomjs-$PHANTOMJS_VERSION-linux-x86_64.tar.bz2; fi"
- "if [ $(phantomjs --version) != $PHANTOMJS_VERSION ]; then tar -xvf $PWD/travis_phantomjs/phantomjs-$PHANTOMJS_VERSION-linux-x86_64.tar.bz2 -C $PWD/travis_phantomjs; fi"
- "if [ $(phantomjs --version) != $PHANTOMJS_VERSION ]; then hash -r; fi"
- "phantomjs --version"
script:
- R -f run_tests.R
notifications:
email: false
<div class="span6">
<ul class="nav nav-tabs" style="margin:0px">
<li role="presentation" id="paste-tab" class="active"><a data-toggle="tab" href="#paste">Paste lists</a></li>
<li role="presentation" id="upload-tab"><a data-toggle="tab" href="#upload">Upload lists</a></li>
</ul>
<div class="tab-content clearfix" style="margin:0px;padding:20px 0 0 20px;border-left:1px solid #ddd;border-right:1px solid #ddd;border-bottom:1px solid #ddd;border-radius:0 0 4px 4px">
<div class="tab-pane active" id="paste">
<div class="row-fluid">
<div class="span6">
<div class="control-group color1">
<input class="span6" id="name_pa_1" type="text" style="font-weight: bold;" value="List 1" maxlength="11"/>
<div id="colorp_pa_1" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#006600" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_1" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_1" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_1" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
<div class="span6">
<div class="control-group color2">
<input class="span6" id="name_pa_2" type="text" style="font-weight: bold;" value="List 2" maxlength="11"/>
<div id="colorp_pa_2" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#5a9bd4" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_2" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_2" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_2" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
</div>
<div class="row-fluid">
<div class="span6">
<div class="control-group color3">
<input class="span6" id="name_pa_3" type="text" style="font-weight: bold;" value="List 3" maxlength="11"/>
<div id="colorp_pa_3" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#f15a60" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_3" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_3" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_3" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
<div class="span6">
<div class="control-group color4">
<input class="span6" id="name_pa_4" type="text" style="font-weight: bold;" value="List 4" maxlength="11"/>
<div id="colorp_pa_4" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#cfcf1b" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_4" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_4" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_4" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
</div>
<div class="row-fluid">
<div class="span6">
<div class="control-group color5">
<input class="span6" id="name_pa_5" type="text" style="font-weight: bold;" value="List 5" maxlength="11"/>
<div id="colorp_pa_5" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#ff7500" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_5" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_5" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_5" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
<div class="span6">
<div class="control-group color6">
<input class="span6" id="name_pa_6" type="text" style="font-weight: bold;" value="List 6" maxlength="11"/>
<div id="colorp_pa_6" class="input-append colorpicker-component colorpicker-element">
<input type="text" value="#c09853" class="form-control" style="display:none"/>
<span class="add-on"><i></i></span>
</div>
<div class="btn-group" style="margin-left:15px">
<button id="colord_pa_6" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-refresh"></i></button>
<button id="clear_pa_6" style="margin-bottom:10px" class="btn btn-mini"><i class="icon-trash"></i></button>
</div>
<div class="controls controls-row">
<textarea class="span11" id="area_pa_6" wrap="off" rows="4" style="resize:none"></textarea>
</div>
</div>
</div>
</div>
</div>
</div>
</div>
\ No newline at end of file
<div class="btn-group" data-toggle="buttons-radio">
<button id="dm_classic" type="button" class="btn btn-mini active">Classic</button>
<button id="dm_edwards" type="button" class="btn btn-mini">Edwards'</button>
</div>
</div>
\ No newline at end of file
......@@ -26,6 +26,14 @@ and also a [video Presentation](https://www.youtube.com/watch?v=lfI0zRYzeJs)
## Installation
MATRiX is available for R>3.5.0. The installation, download and execution can all be performed with a small R script :
First you'll need to install RJava in the aim of using RDAVIDWebService.
You can download it with the following commands:
```
sudo apt-get install default-jdk
sudo R CMD javareconf to associate it with R
sudo apt-get install r-cran-rjava
sudo apt-get install libgdal1-dev libproj-dev
```
```
## Download RDAVIDWebService
source("https://bioconductor.org/biocLite.R")
......
File deleted
library(DiagrammeR)
mermaid("
gantt
dateFormat YYYY-MM-DD
title A Very Nice Gantt Diagram
section Basic Tasks
This is completed :done, first_1, 2014-01-06, 2014-01-08
This is active :active, first_2, 2014-01-09, 3d
Do this later : first_3, after first_2, 5d
Do this after that : first_4, after first_3, 5d
section Important Things
Completed, critical task :crit, done, import_1, 2014-01-06,24h
Also done, also critical :crit, done, import_2, after import_1, 2d
Doing this important task now :crit, active, import_3, after import_2, 3d
Next critical task :crit, import_4, after import_3, 5d
section The Extras
First extras :active, extras_1, after import_4, 3d
Second helping : extras_2, after extras_1, 20h
More of the extras : extras_3, after extras_1, 48h
")
df <- data.frame(task = c("Recherche bibliographique", "Elaboration d'un cahier des charges", "Conception de l'architecture",
"Implémentation sous R", "Implémentation sous Shiny",
"Déploiement de MATRiX en ligne", "Maintenance de MATRiX", "Optimisation du code", "Rédaction du rapport de stage"),
status = c("active", "active", "active"),
pos = c("first_1", "first_2", "first_3","first_4", "first_5","first_6", "first_7", "first_8", "first_9"),
start = c("03-05", "03-05", "after first_1"),
end = c("08-31", "3d", "5d"))
View(df)
df <- data.frame(task = c("Recherche bibliographique", "Elaboration d'un cahier des charges",
"Conception de l'architecture",
"Implémentation sous R", "Implémentation sous Shiny",
"Déploiement de MATRiX en ligne", "Maintenance de MATRiX", "Optimisation du code", "Rédaction du rapport de stage"),
status = c("active", "active", "active"),
pos = c("first_1", "first_2", "first_3","first_4", "first_5","first_6", "first_7", "first_8", "first_9"),
start = c("03-05", "03-05", "after first_1"),
end = c("08-31", "3d", "5d"))
library(reshape2)
library(ggplot2)
rm(list = ls())
task1 <- c('Recherche bibliographique', '2018-03-05', '2018-03-25')
task2 <- c('Elaboration d"un cahier des charges', '2018-03-25', '2018-04-15')
task3 <- c('Conception de l"architecture', '2018-04-15', '2018-04-30')
task4 <- c('Implémentation du code source', '2018-04-20', '2018-06-30')
task5 <- c('Déploiement de MATRiX en ligne', '2018-05-10', '2018-06-20')
task6 <- c('Bêta test', '2018-05-20', '2018-05-22')
task7 <- c('Optimisation/Correction des bugs', '2018-06-20', '2018-08-20')
task8 <- c('Maintenance de MATRiX', '2018-06-20', '2018-07-01')
task9 <- c('Rédaction du rapport de stage', '2018-07-15', '2018-08-20')
df <- as.data.frame(rbind(task1, task2, task3, task4,task5, task6, task7, task8, task9))
names(df) <- c('task', 'start', 'end')
df$task <- factor(df$task, levels = df$task)
df$start <- as.Date(df$start)
df$end <- as.Date(df$end)
df_melted <- melt(df, measure.vars = c('start', 'end'))
# starting date to begin plot
start_date <- as.Date('2018-03-05')
ggplot(df_melted, aes(value, task)) +
geom_line(size = 10) +
labs(x = '', y = '', title = "Diagramme des tâche effectuées") +
theme_bw(base_size = 20) +
theme(plot.title = element_text(hjust = 0.5),
panel.grid.major.x = element_line(colour="black", linetype = "dashed"),
panel.grid.major = element_blank(),
panel.grid.minor = element_blank(),
axis.text.x = element_text(angle = 0)) +
scale_x_date(date_labels = "%Y %b")
# see ?strptime if you want your date in a different format
# see ?strptime if you want your date in a different format
# see http://docs.ggplot2.org/current/scale_date.html if you want to adjust the x-axis
# see ?strptime if you want your date in a different format
# see http://docs.ggplot2.org/current/scale_date.html if you want to adjust the x-axis
# see ?strptime if you want your date in a different format
# see http://docs.ggplot2.org/current/scale_date.html if you want to adjust the x-axis
# see ?strptime if you want your date in a different format
# see http://docs.ggplot2.org/current/scale_date.html if you want to adjust the x-axis
No preview for this file type
......@@ -43,6 +43,7 @@ background-color: #fff;
Errorcss <-
".shiny-output-error { visibility: visible; color: #3c8dbc;}
.shiny-output-error:before {
color: #3c8dbc;
visibility: visible;
......@@ -52,7 +53,6 @@ content: 'ok'; }
"
appCSS <- "
#loading-content {
position: absolute;
......
......@@ -41,6 +41,7 @@ h2 {
font-size: 20px;
}
p {
/*
font-family: 'Inconsolata', cursive;*/
......@@ -104,6 +105,15 @@ color: white;
position: static;
}
#mytextvolcgrep p{
font-weight: 700;
font-size: 14px;
line-height: 1.5;
color: white;
position: static;
}
.nav-tabs-custom > .nav-tabs > li.active:hover > a, .nav-tabs-custom > .nav-tabs > li.active > a {
background-color: #3c8dbc;
......@@ -220,4 +230,6 @@ div.outer {
left: 0px;
right: 0px;
bottom: 0px;
}
\ No newline at end of file
}
"";"Row";"Col";"Start";"Sequence";"ProbeName";"GeneName";"SystematicName";"Description";"Amean";"logFC_LWT_CARBO-LWT_CTRL";"logFC_LKO_CARBO-LKO_CTRL";"logFC_LKO_CARBO-LWT_CARBO";"logFC_LKO_CTRL-LWT_CTRL";"logFC_(LWT_CARBO-LWT_CTRL)-(LKO_CARBO-LKO_CTRL)";"t_LWT_CARBO-LWT_CTRL";"t_LKO_CARBO-LKO_CTRL";"t_LKO_CARBO-LWT_CARBO";"t_LKO_CTRL-LWT_CTRL";"t_(LWT_CARBO-LWT_CTRL)-(LKO_CARBO-LKO_CTRL)";"P.value_LWT_CARBO-LWT_CTRL";"P.value_LKO_CARBO-LKO_CTRL";"P.value_LKO_CARBO-LWT_CARBO";"P.value_LKO_CTRL-LWT_CTRL";"P.value_(LWT_CARBO-LWT_CTRL)-(LKO_CARBO-LKO_CTRL)";"adj.P.Val_LWT_CARBO-LWT_CTRL";"adj.P.Val_LKO_CARBO-LKO_CTRL";"adj.P.Val_LKO_CARBO-LWT_CARBO";"adj.P.Val_LKO_CTRL-LWT_CTRL";"adj.P.Val_(LWT_CARBO-LWT_CTRL)-(LKO_CARBO-LKO_CTRL)";"q.value_LWT_CARBO-LWT_CTRL";"q.value_LKO_CARBO-LKO_CTRL";"q.value_LKO_CARBO-LWT_CARBO";"q.value_LKO_CTRL-LWT_CTRL";"q.value_(LWT_CARBO-LWT_CTRL)-(LKO_CARBO-LKO_CTRL)"
"";"Row";"Col";"Start";"Sequence";"ProbeName";"GeneName";"SystematicName";"Description";"Amean";"logFC_WT_CARBO-WT_CTRL";"logFC_KO_CARBO-KO_CTRL";"logFC_KO_CARBO-WT_CARBO";"logFC_KO_CTRL-WT_CTRL";"logFC_(WT_CARBO-WT_CTRL)-(KO_CARBO-KO_CTRL)";"t_WT_CARBO-WT_CTRL";"t_KO_CARBO-KO_CTRL";"t_KO_CARBO-WT_CARBO";"t_KO_CTRL-WT_CTRL";"t_(WT_CARBO-WT_CTRL)-(KO_CARBO-KO_CTRL)";"P.value_WT_CARBO-WT_CTRL";"P.value_KO_CARBO-KO_CTRL";"P.value_KO_CARBO-WT_CARBO";"P.value_KO_CTRL-WT_CTRL";"P.value_(WT_CARBO-WT_CTRL)-(KO_CARBO-KO_CTRL)";"adj.P.Val_WT_CARBO-WT_CTRL";"adj.P.Val_KO_CARBO-KO_CTRL";"adj.P.Val_KO_CARBO-WT_CARBO";"adj.P.Val_KO_CTRL-WT_CTRL";"adj.P.Val_(WT_CARBO-WT_CTRL)-(KO_CARBO-KO_CTRL)";"q.value_WT_CARBO-WT_CTRL";"q.value_KO_CARBO-KO_CTRL";"q.value_KO_CARBO-WT_CARBO";"q.value_KO_CTRL-WT_CTRL";"q.value_(WT_CARBO-WT_CTRL)-(KO_CARBO-KO_CTRL)"
"5";1;5;362;"TAAACAAAGGGATGTCCAAGATGGATGCCATGAGGATCTACATTGCTAAAGTGGAAGAGC";"A_52_P169082";"Dbil5";"NM_021294";"ref|Mus musculus diazepam binding inhibitor-like 5 (Dbil5), mRNA [NM_021294]";6,61627736339569;0,562915867418613;0,448619741076511;0,0313180878794492;0,145614214221551;0,114296126342102;4,42237144168452;3,52443987804183;0,246040706014148;1,14397226965684;0,634933497693186;0,000189332110787572;0,00178020030653358;0,807793601518406;0,264189818768994;0,531624546886217;0,000749769083854331;0,00596075509634653;0,999613879091774;0,718488647936931;0,908910372970811;0,000212443851131506;0,00182646640807108;0,999613879091774;0,595490999272346;0,785603566075074
"8";1;8;2292;"TAATCTTTGAATTTCATCTGTAGCTGAGTGACAGGTGTGTTTGGAGCAGTCATTAAATGA";"A_51_P414243";"C85492";"NM_153540";"ref|Mus musculus expressed sequence C85492 (C85492), mRNA [NM_153540]";9,77942607018488;-0,0677525752896742;0,0815399325170514;0,0977348120990804;-0,0515576957076451;-0,149292507806726;-0,462043574081963;0,556067451155947;0,666509600578541;-0,35160142465937;-0,719913209946515;0,648312258041261;0,583437305912509;0,511596505759537;0,728279943607603;0,478699891674471;0,724479697741461;0,676295619247807;0,999613879091774;0,942369618902087;0,894617524096235;0,205278212144432;0,207227307701141;0,999613879091774;0,781045918617163;0,773249748383965
"13";1;13;0;"TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG";"A_30_P01024440";"chr17:3213918-3257944_F";"chr17:3213918-3257944_F";"lincRNA:chr17:3213918-3257944 forward strand";7,89543832811276;-0,767602981356583;-0,698935524963172;0,00740749448965072;-0,0612599619037599;-0,0686674563934107;-6,54638930686836;-5,9607689885767;0,0631737289920831;-0,522446589299582;-0,414096098264661;1,01728954159493e-06;4,13694286216819e-06;0,950164091096582;0,606265178942582;0,682570532800468;9,29494371459709e-06;3,93616602019865e-05;0,999613879091774;0,902245269336473;0,948416735967956;2,6336823980905e-06;1,20610139089427e-05;0,999613879091774;0,7477904328324;0,819750320888499
"";"LWT_Ctrl2";"LWT_CARBO5";"LKO_Ctrl3";"LKO_CARBO1";"LKO_CARBO4";"LKO_Ctrl6";"LWT_CARBO2";"LWT_Ctrl5";"LWT_CARBO1";"LWT_Ctrl6";"LKO_CARBO5";"LKO_Ctrl1";"LKO_Ctrl4";"LKO_CARBO2";"LWT_Ctrl3";"LWT_CARBO4";"LKO_CARBO3";"LKO_Ctrl5";"LWT_CARBO6";"LWT_Ctrl4";"LWT_Ctrl1";"LWT_CARBO3";"LKO_Ctrl2";"LKO_CARBO6"
"";"WT_Ctrl2";"WT_CARBO5";"KO_Ctrl3";"KO_CARBO1";"KO_CARBO4";"KO_Ctrl6";"WT_CARBO2";"WT_Ctrl5";"WT_CARBO1";"WT_Ctrl6";"KO_CARBO5";"KO_Ctrl1";"KO_Ctrl4";"KO_CARBO2";"WT_Ctrl3";"WT_CARBO4";"KO_CARBO3";"KO_Ctrl5";"WT_CARBO6";"WT_Ctrl4";"WT_Ctrl1";"WT_CARBO3";"KO_Ctrl2";"KO_CARBO6"
"5";6,39119538125904;6,51161196163122;6,17327000073008;7,00737035858636;6,75972368977485;6,27640315306484;7,06383670313445;6,18557752551848;7,36097831360671;6,20882659786095;7,03379848261445;6,93933087259292;6,4091782919207;6,9031873368031;6,39070374030868;6,56016526805487;6,87950993380334;6,27640315306484;6,87950993380334;6,17020769381354;6,39700718620613;6,74491114924788;6,54261793892276;6,72533205517309
"8";9,91914488659141;9,97519571956073;9,69268149484447;10,479470032203;10,0395501309461;9,74503545578022;9,66219723163493;9,59365743647717;9,68837684311658;9,85010385585239;9,64533983815591;10,0750820551278;9,46289144876188;9,99160846596157;10,109938696399;9,93316509974097;9,38088537604921;9,70406070244169;9,5750912816301;9,63341116264611;9,70429243442509;9,57000684496981;9,82145114118923;9,45358804993181
"13";8,22965233780903;7,03466673932052;8,09218364495904;7,15021203448071;7,69766214665205;8,29274038572099;7,38378825418484;8,1658838531975;7,80436914448141;8,30558469580936;7,57977816236765;8,11252219632095;8,23996943578761;7,50395981826468;8,45887789669595;7,44802089841308;7,55852787955744;8,55440095393713;7,80779478479437;8,22058126033239;8,37563757002326;7,67195990453376;8,09684122571923;7,70490465134338
"";"Grp"
"LWT_Ctrl2";"LWT_CTRL"
"LWT_CARBO5";"LWT_CARBO"
"LKO_Ctrl3";"LKO_CTRL"
"LKO_CARBO1";"LKO_CARBO"
"LKO_CARBO4";"LKO_CARBO"
"LKO_Ctrl6";"LKO_CTRL"
"LWT_CARBO2";"LWT_CARBO"
"LWT_Ctrl5";"LWT_CTRL"
"LWT_CARBO1";"LWT_CARBO"
"LWT_Ctrl6";"LWT_CTRL"
"LKO_CARBO5";"LKO_CARBO"
"LKO_Ctrl1";"LKO_CTRL"
"LKO_Ctrl4";"LKO_CTRL"
"LKO_CARBO2";"LKO_CARBO"
"LWT_Ctrl3";"LWT_CTRL"
"LWT_CARBO4";"LWT_CARBO"
"LKO_CARBO3";"LKO_CARBO"
"LKO_Ctrl5";"LKO_CTRL"
"LWT_CARBO6";"LWT_CARBO"
"LWT_Ctrl4";"LWT_CTRL"
"LWT_Ctrl1";"LWT_CTRL"
"LWT_CARBO3";"LWT_CARBO"
"LKO_Ctrl2";"LKO_CTRL"
"LKO_CARBO6";"LKO_CARBO"
"WT_Ctrl2";"WT_CTRL"
"WT_CARBO5";"WT_CARBO"
"KO_Ctrl3";"KO_CTRL"
"KO_CARBO1";"KO_CARBO"
"KO_CARBO4";"KO_CARBO"
"KO_Ctrl6";"KO_CTRL"
"WT_CARBO2";"WT_CARBO"
"WT_Ctrl5";"WT_CTRL"
"WT_CARBO1";"WT_CARBO"
"WT_Ctrl6";"WT_CTRL"
"KO_CARBO5";"KO_CARBO"
"KO_Ctrl1";"KO_CTRL"
"KO_Ctrl4";"KO_CTRL"
"KO_CARBO2";"KO_CARBO"
"WT_Ctrl3";"WT_CTRL"
"WT_CARBO4";"WT_CARBO"
"KO_CARBO3";"KO_CARBO"
"KO_Ctrl5";"KO_CTRL"
"WT_CARBO6";"WT_CARBO"
"WT_Ctrl4";"WT_CTRL"
"WT_Ctrl1";"WT_CTRL"
"WT_CARBO3";"WT_CARBO"
"KO_Ctrl2";"KO_CTRL"
"KO_CARBO6";"KO_CARBO"
No preview for this file type
<
# Author: Kevin Blighe
# Title: Publication-ready volcano plots with enhanced colouring and labelign
# Github: https://github.com/kevinblighe/EnhancedVolcano
# Modified by Franck Soubès (add topgenes)
# Modified by Franck Soubès (add 74-85; modify 98-107, add 3 parameters displayLab, findfamily, topgenes)
EnhancedVolcano <- function(
toptable,
......@@ -10,6 +10,7 @@ EnhancedVolcano <- function(
y,
selectLab = NULL,
displaylab = NULL,
findfamily = NULL,
topgenes = NULL,
xlim = c(min(toptable[,x], na.rm=TRUE),
max(toptable[,x], na.rm=TRUE)),
......@@ -22,8 +23,8 @@ EnhancedVolcano <- function(
FCcutoff = 2.0,
title = "",
titleLabSize = 16,
transcriptPointSize = 0.8,
transcriptLabSize = 2.0,
transcriptPointSize = 2.8,
transcriptLabSize = 5.0,
col = c("grey30", "forestgreen", "royalblue", "red2"),
colAlpha = 1/2,
legend = c("NS","Log2 FC","P","P & Log2 FC"),
......@@ -58,8 +59,13 @@ EnhancedVolcano <- function(
requireNamespace("ggrepel")
requireNamespace("dplyr")
i <- xvals <- yvals <- Sig <- NULL
toptable <- as.data.frame(toptable)
toptable$GeneName <- sapply(toptable$GeneName, function(v) {
if (is.character(v)) return(toupper(v))
else return(v)